Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASA4 cdna clone

RASA4 cDNA Clone

Gene Names
RASA4; GAPL; CAPRI
Synonyms
RASA4; RASA4 cDNA Clone; RASA4 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaagcgcagctcgctgtacatccgcatcgtggaggggaagaaccttcccgccaaggacatcactggcagcagcgacccctactgcatcgtgaaggtggacaatgagcccatcatcaggacagccacagtgtggaagaccctgtgccccttctggggtgaggagtaccaagtgcacctgccgcccaccttccacgctgtggctttctatgtcatggatgaggatgccctcagccgggacgacgttatcggaaaggtctgccttacaagggacaccatagcctctcaccctaagggtttcagcgggtgggcccacctgacggaggtcgaccccgacgaggaggtgcagggcgagatccacctgcggctggaagtgtggccaggggcccgggcctgccggctacgctgctctgtgctggaggccagggatctggccccaaaggaccgcaatggcacatctgaccccttcgtccgagtgcgctacaagggccggacacgggagacctcgatcgtgaagaagtcatgctacccacgctggaatgagacgtttgaatttgagctgcaggagggggccatggaggcgctgtgcgtggaggcctgggactgggacctcgtcagccgaaacgacttcctgggcaaagtggtgattgatgtccagagactgcgggtggtgcagcaggaggagggctggttccggctgcagcccgaccagtccaagagccggcggcatgacgagggcaacctgggctccttgcagctggaggtgcggctgcgggacgagacggtgctgccctccagctactaccagccactggtgcacctgctgtgccacgaggtcaagctgggcatgcagggcccagggcagctgatcccactcatcgaggagacaaccagcaccgagtgtcgccaggacgtggccacgaacctgctcaagctcttcctggggcaggggctggccaaggacttcctggacctgctcttccagctggagctgagtcgcaccagtgagaccaacaccctgttccggagcaactctctggcctcaaagtccgtggagtcttttctgaaggtggccgggatgcagtacctgcacggcgtcctgggccccatcatcaacaaggtgtttgaggagaagaagtacgtggagctggaccccagcaaagtggaagttaaggatgtagggtgctccgggctgcaccgcccgcagaccgaggccgaggtgctggagcagagcgcgcagacgctgcgcgcccacctgggggccctgctgagcgcgctcagccgctcggttcgcgcgtgccccgctgtggtgcgcgccaccttccgccagctcttccggcgcgtgcgcgagcgcttccccggcgcccagcacgagaatgtaccgttcatcgccgtcaccagcttcctgtgcctgcgcttcttctctcccgccatcatgtcgcccaagctcttccacctgcgggagcgccacgcggacgcccgcaccagccgcaccctgctcctgttggccaaggcagtccagaacgtgggcaacatggacacgccggcttccagggccaaggaggcttggatggagccgctgcagcccaccgtgcgccagggcgtggcgcagctgaaggacttcatcaccaagctcgtggacatcgaggagaaggacgagctggacctgcagcggacgctgagtttgcaggcgccacctgtgaaggaggggccactcttcatccacaggaccaagggcaagggccccctcatgtcctcctccttcaagaagctctacttctccctcactaccgaggccctcagcttcgcgaagacgcccagctccaagaaaagcgccctcatcaagttagccaacatccgggcagcggaaaaggttgaggaaaagagctttggcggctcgcacgtcatgcaggtcatctacacggacgacgccggcaggccccagactgcctacctgcagtgcaagtgtgtgaatgagcttaaccagtggctgtctgcgctgcggaaggtgagcatcaacaacaccggactgctgggctcctaccaccctggcgtcttccgtggggacaagtggagctgctgccaccaaaaagagaagacaggtcagggctgcgataagacccggtcacgggtgaccctgcaggagtggaatgaccctcttgaccatgaccttgaggcccagctcatctaccggcacctgctgggcgtggaggccatgctgtgggagaggcaccgggagctgagcgggggcgcagaggcaggcacggtgcccacgagccctggcaaagtccccgaggactcattggcccggctgctccgggtgctgcaggacctccgcgaggcccatagctccagcccggccggctccccaccctcagagcccaactgcctcctggagctgcagacgtga
Sequence Length
2412
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,409 Da
NCBI Official Full Name
Homo sapiens RAS p21 protein activator 4, mRNA
NCBI Official Synonym Full Names
RAS p21 protein activator 4
NCBI Official Symbol
RASA4
NCBI Official Synonym Symbols
GAPL; CAPRI
NCBI Protein Information
ras GTPase-activating protein 4
UniProt Protein Name
Ras GTPase-activating protein 4
UniProt Gene Name
RASA4
UniProt Synonym Gene Names
CAPRI; GAPL; KIAA0538
UniProt Entry Name
RASL2_HUMAN

NCBI Description

This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

RASA4: Ca(2+)-dependent Ras GTPase-activating protein, that switches off the Ras-MAPK pathway following a stimulus that elevates intracellular calcium. Functions as an adaptor for Cdc42 and Rac1 during FcR-mediated phagocytosis. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs, Ras; GAPs

Chromosomal Location of Human Ortholog: 7q22

Cellular Component: cytosol; plasma membrane

Molecular Function: GTPase activator activity

Biological Process: MAPKKK cascade; negative regulation of Ras protein signal transduction

Research Articles on RASA4

Similar Products

Product Notes

The RASA4 rasa4 (Catalog #AAA1269270) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaagc gcagctcgct gtacatccgc atcgtggagg ggaagaacct tcccgccaag gacatcactg gcagcagcga cccctactgc atcgtgaagg tggacaatga gcccatcatc aggacagcca cagtgtggaa gaccctgtgc cccttctggg gtgaggagta ccaagtgcac ctgccgccca ccttccacgc tgtggctttc tatgtcatgg atgaggatgc cctcagccgg gacgacgtta tcggaaaggt ctgccttaca agggacacca tagcctctca ccctaagggt ttcagcgggt gggcccacct gacggaggtc gaccccgacg aggaggtgca gggcgagatc cacctgcggc tggaagtgtg gccaggggcc cgggcctgcc ggctacgctg ctctgtgctg gaggccaggg atctggcccc aaaggaccgc aatggcacat ctgacccctt cgtccgagtg cgctacaagg gccggacacg ggagacctcg atcgtgaaga agtcatgcta cccacgctgg aatgagacgt ttgaatttga gctgcaggag ggggccatgg aggcgctgtg cgtggaggcc tgggactggg acctcgtcag ccgaaacgac ttcctgggca aagtggtgat tgatgtccag agactgcggg tggtgcagca ggaggagggc tggttccggc tgcagcccga ccagtccaag agccggcggc atgacgaggg caacctgggc tccttgcagc tggaggtgcg gctgcgggac gagacggtgc tgccctccag ctactaccag ccactggtgc acctgctgtg ccacgaggtc aagctgggca tgcagggccc agggcagctg atcccactca tcgaggagac aaccagcacc gagtgtcgcc aggacgtggc cacgaacctg ctcaagctct tcctggggca ggggctggcc aaggacttcc tggacctgct cttccagctg gagctgagtc gcaccagtga gaccaacacc ctgttccgga gcaactctct ggcctcaaag tccgtggagt cttttctgaa ggtggccggg atgcagtacc tgcacggcgt cctgggcccc atcatcaaca aggtgtttga ggagaagaag tacgtggagc tggaccccag caaagtggaa gttaaggatg tagggtgctc cgggctgcac cgcccgcaga ccgaggccga ggtgctggag cagagcgcgc agacgctgcg cgcccacctg ggggccctgc tgagcgcgct cagccgctcg gttcgcgcgt gccccgctgt ggtgcgcgcc accttccgcc agctcttccg gcgcgtgcgc gagcgcttcc ccggcgccca gcacgagaat gtaccgttca tcgccgtcac cagcttcctg tgcctgcgct tcttctctcc cgccatcatg tcgcccaagc tcttccacct gcgggagcgc cacgcggacg cccgcaccag ccgcaccctg ctcctgttgg ccaaggcagt ccagaacgtg ggcaacatgg acacgccggc ttccagggcc aaggaggctt ggatggagcc gctgcagccc accgtgcgcc agggcgtggc gcagctgaag gacttcatca ccaagctcgt ggacatcgag gagaaggacg agctggacct gcagcggacg ctgagtttgc aggcgccacc tgtgaaggag gggccactct tcatccacag gaccaagggc aagggccccc tcatgtcctc ctccttcaag aagctctact tctccctcac taccgaggcc ctcagcttcg cgaagacgcc cagctccaag aaaagcgccc tcatcaagtt agccaacatc cgggcagcgg aaaaggttga ggaaaagagc tttggcggct cgcacgtcat gcaggtcatc tacacggacg acgccggcag gccccagact gcctacctgc agtgcaagtg tgtgaatgag cttaaccagt ggctgtctgc gctgcggaag gtgagcatca acaacaccgg actgctgggc tcctaccacc ctggcgtctt ccgtggggac aagtggagct gctgccacca aaaagagaag acaggtcagg gctgcgataa gacccggtca cgggtgaccc tgcaggagtg gaatgaccct cttgaccatg accttgaggc ccagctcatc taccggcacc tgctgggcgt ggaggccatg ctgtgggaga ggcaccggga gctgagcggg ggcgcagagg caggcacggt gcccacgagc cctggcaaag tccccgagga ctcattggcc cggctgctcc gggtgctgca ggacctccgc gaggcccata gctccagccc ggccggctcc ccaccctcag agcccaactg cctcctggag ctgcagacgt ga. It is sometimes possible for the material contained within the vial of "RASA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.