Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EVI5L cdna clone

EVI5L cDNA Clone

Synonyms
EVI5L; EVI5L cDNA Clone; EVI5L cdna clone
Ordering
For Research Use Only!
Sequence
atggcgagccccactctgagccccgactcctcatcccaggaggccctgtcggcccccacctgctccccaacctctgactccgagaacctcagccccgatgagctggagctgctggccaagctcgaagagcagaaccggctcctggaggccgactccaagtccatgcgctccatgaatggctcgcggcggaacagtggctcctcgctagtgtccagctcctcggcctcctccaacctgagccacctggaggaggacacgtggatcctgtggggccggatcgccaacgagtgggaggagtggcggcgcaggaaggagaagctgctcaaggagctgatccgcaagggcatcccccaccacttccgggccatcgtgtggcagcttctgtgcagcgccacggacatgcccgtcaagaaccagtactccgagctgctcaagatgtcctcgccgtgcgagaagctgatccgcagggacatcgcccgcacctacccggaacacgagttcttcaagggccaggacagcctgggccaggaggtcctcttcaacgtcatgaaggcatactcgctggtagaccgggaggtgggctactgccagggaagcgccttcatcgtgggcctgctcctcatgcagatgcctgaggaggaggccttctgtgtgttcgtgcggctgatgcaggagtaccggctgcgggagctcttcaaacccagcatggccgagctcgggctctgcatctatcagttcgagtacatgctgcaggagcagctcccagacctcaacacccacttccgttcccaaagcttccacacatccatgtatgcctcgtcctggttcctcacactgttcctgaccaccttcccactccccgtcgccacccgggtctttgacatcttcatgtatgaggggctggagatcgtgttccgagtgggcctcgccctgctgcaggtgaaccaggcggagctgatgcagctggacatggaggggatgtcccagtacttccagagagtgatcccccaccagttcgacagctgcccggacaagctggtcctcaaagcctaccaggtcaagtacaaccccaagaagatgaagaggctggagaaggagtacgcagccatgaagagcaaggagatggaggagcagatcgagatcaaaagacttcggacggagaaccggctcctgaaacagcggattgaaaccctagagaaggggcaagtgacacgggcgcaggaggcggaggagaactacgtcatcaagcgggagctggcggtggtgcggcagcagtgcagctcggcggccgaggacctgcagaaggcacagagcaccatccggcagctacaggagcagcaggagaacccccgcctcacagaagacttcgtgtcccacctggagaccgagctggagcagtcgaggctgcgggagacggagacactgggggcccttcgggagatgcaggacaaggttctcgacatggaaaagaggaacagctcgctgcccgacgagaacaatgtggcgcagctgcaggaggagctgaaggcgctcaaggtgcgggaaggccaggcggtggcctcgacgcgagagcttaaactgcagctgcaggagctctcggacacctggcaggcccatctggcccgcggcggccgctggaaggagtccccacggaagctggtcgtgggcgagctgcaggacgagctgatgagcgtgcgtctgcgcgaggcccaggccctggccgagggccgcgagctgcggcagcgcgtggtggaacttgagacgcaggaccacatccaccgcaaccttttgaaccgcgtggaggcggagcgcgcggcgctgcaggagaagctgcagtacctggctgcacagaacaaggggctgcagacgcagctcagcgaaagccgccgcaagcaggccgaggccgagtgcaagagcaaggaggaggtgatggctgtgcgactgcgggaggcggacagcatggctgcggtggccgagatgcggcagcgcattgccgagctggagatccagagggaggaaggccgcatccagggccagctgaaccactcggactcatcgcagtacatccgcgagctcaaggaccagatcgaggagctgaaggccgaggtgcggctgctgaagggcccgccgcccttcgaggacccgctggctttcgatgggctgagcctggcgcggcacttggacgaggactcgctgccgtcgtcggacgaggagctacttggcgtaggcgtgggcgctgccctgcaggacgcattgtaccctctgtccccgcgcgatgcgcgcttcttccgccgtctggagcggccggccaaggacagcgagggcagctcagacagcgacgccgatgagctggccgcgccctacagccagggtctggacaactga
Sequence Length
2385
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,544 Da
NCBI Official Full Name
Homo sapiens ecotropic viral integration site 5-like, mRNA
NCBI Official Synonym Full Names
ecotropic viral integration site 5 like
NCBI Official Symbol
EVI5L
NCBI Protein Information
EVI5-like protein
UniProt Protein Name
EVI5-like protein
Protein Family
UniProt Gene Name
EVI5L
UniProt Entry Name
EVI5L_HUMAN

Uniprot Description

EVI5L: Functions as a GTPase-activating protein (GAP) with a broad specificity. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs, Rab; GAPs

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: endomembrane system; intracellular

Molecular Function: GTPase activator activity; protein binding; Rab GTPase binding

Biological Process: intracellular protein transport; regulation of vesicle fusion

Similar Products

Product Notes

The EVI5L evi5l (Catalog #AAA1269187) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgagcc ccactctgag ccccgactcc tcatcccagg aggccctgtc ggcccccacc tgctccccaa cctctgactc cgagaacctc agccccgatg agctggagct gctggccaag ctcgaagagc agaaccggct cctggaggcc gactccaagt ccatgcgctc catgaatggc tcgcggcgga acagtggctc ctcgctagtg tccagctcct cggcctcctc caacctgagc cacctggagg aggacacgtg gatcctgtgg ggccggatcg ccaacgagtg ggaggagtgg cggcgcagga aggagaagct gctcaaggag ctgatccgca agggcatccc ccaccacttc cgggccatcg tgtggcagct tctgtgcagc gccacggaca tgcccgtcaa gaaccagtac tccgagctgc tcaagatgtc ctcgccgtgc gagaagctga tccgcaggga catcgcccgc acctacccgg aacacgagtt cttcaagggc caggacagcc tgggccagga ggtcctcttc aacgtcatga aggcatactc gctggtagac cgggaggtgg gctactgcca gggaagcgcc ttcatcgtgg gcctgctcct catgcagatg cctgaggagg aggccttctg tgtgttcgtg cggctgatgc aggagtaccg gctgcgggag ctcttcaaac ccagcatggc cgagctcggg ctctgcatct atcagttcga gtacatgctg caggagcagc tcccagacct caacacccac ttccgttccc aaagcttcca cacatccatg tatgcctcgt cctggttcct cacactgttc ctgaccacct tcccactccc cgtcgccacc cgggtctttg acatcttcat gtatgagggg ctggagatcg tgttccgagt gggcctcgcc ctgctgcagg tgaaccaggc ggagctgatg cagctggaca tggaggggat gtcccagtac ttccagagag tgatccccca ccagttcgac agctgcccgg acaagctggt cctcaaagcc taccaggtca agtacaaccc caagaagatg aagaggctgg agaaggagta cgcagccatg aagagcaagg agatggagga gcagatcgag atcaaaagac ttcggacgga gaaccggctc ctgaaacagc ggattgaaac cctagagaag gggcaagtga cacgggcgca ggaggcggag gagaactacg tcatcaagcg ggagctggcg gtggtgcggc agcagtgcag ctcggcggcc gaggacctgc agaaggcaca gagcaccatc cggcagctac aggagcagca ggagaacccc cgcctcacag aagacttcgt gtcccacctg gagaccgagc tggagcagtc gaggctgcgg gagacggaga cactgggggc ccttcgggag atgcaggaca aggttctcga catggaaaag aggaacagct cgctgcccga cgagaacaat gtggcgcagc tgcaggagga gctgaaggcg ctcaaggtgc gggaaggcca ggcggtggcc tcgacgcgag agcttaaact gcagctgcag gagctctcgg acacctggca ggcccatctg gcccgcggcg gccgctggaa ggagtcccca cggaagctgg tcgtgggcga gctgcaggac gagctgatga gcgtgcgtct gcgcgaggcc caggccctgg ccgagggccg cgagctgcgg cagcgcgtgg tggaacttga gacgcaggac cacatccacc gcaacctttt gaaccgcgtg gaggcggagc gcgcggcgct gcaggagaag ctgcagtacc tggctgcaca gaacaagggg ctgcagacgc agctcagcga aagccgccgc aagcaggccg aggccgagtg caagagcaag gaggaggtga tggctgtgcg actgcgggag gcggacagca tggctgcggt ggccgagatg cggcagcgca ttgccgagct ggagatccag agggaggaag gccgcatcca gggccagctg aaccactcgg actcatcgca gtacatccgc gagctcaagg accagatcga ggagctgaag gccgaggtgc ggctgctgaa gggcccgccg cccttcgagg acccgctggc tttcgatggg ctgagcctgg cgcggcactt ggacgaggac tcgctgccgt cgtcggacga ggagctactt ggcgtaggcg tgggcgctgc cctgcaggac gcattgtacc ctctgtcccc gcgcgatgcg cgcttcttcc gccgtctgga gcggccggcc aaggacagcg agggcagctc agacagcgac gccgatgagc tggccgcgcc ctacagccag ggtctggaca actga. It is sometimes possible for the material contained within the vial of "EVI5L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.