Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPA1 cdna clone

RPA1 cDNA Clone

Gene Names
RPA1; HSSB; RF-A; RP-A; REPA1; RPA70; MST075
Synonyms
RPA1; RPA1 cDNA Clone; RPA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcggccaactgagcgagggggccattgcggccatcatgcagaagggggatacaaacataaagcccatcctccaagtcatcaacatccgtcccattactacggggaatagtccgccgcgttatcgactgctcatgagtgatggattgaacactctatcctctttcatgttggcgacacagttgaaccctctcgtggaggaagaacaattgtccagcaactgtgtatgccagattcacagatttattgtgaacactctgaaagacggaaggagagtagttatcttgatggaattagaagttttgaagtcagctgaagcagttggagtgaagattggcaatccagtgccctataatgaaggactcgggcagccgcaagtagctcctccagcgccagcagccagcccagcagcaagcagcaggccccagccgcagaatggaagctcgggaatgggttctactgtttctaaggcttatggtgcttcaaagacatttggaaaagctgcaggtcccagcctgtcacacacttctgggggaacacagtccaaagtggtgcccattgccagcctcactccttaccagtccaagtggaccatttgtgctcgtgttaccaacaaaagtcagatccgtacctggagcaactcccgaggggaagggaagcttttctccctagaactggttgacgaaagtggtgaaatccgagctacagctttcaatgagcaagtggacaagttctttcctcttattgaagtgaacaaggtgtattatttctcgaaaggcaccctgaagattgctaacaagcagttcacagctgttaaaaatgactacgagatgaccttcaataacgagacttccgtcatgccctgtgaggacgaccatcatttacctacggttcagtttgatttcacggggattgatgacctcgagaacaagtcgaaagactcacttgtagacatcatcgggatctgcaagagctatgaagacgccactaaaatcacagtgaggtctaacaacagagaagttgccaagaggaatatctacttgatggacacatctgggaaggtggtgactgctacactgtggggggaagatgctgataaatttgatggttctagacagcccgtgttggctatcaaaggagcccgagtctctgatttcggtggacggagcctctccgtgctgtcttcaagcactatcattgcgaatcctgacatcccagaggcctataagcttcgtggatggtttgacgcagaaggacaagccttagatggtgtttccatctctgatctaaagagcggcggagtcggagggagtaacaccaactggaaaaccttgtatgaggtcaaatccgagaacctgggccaaggcgacaagccggactactttagttctgtggccacagtggtgtatcttcgcaaagagaactgcatgtaccaagcctgcccgactcaggactgcaataagaaagtgattgatcaacagaatggattgtaccgctgtgagaagtgcgacaccgaatttcccaatttcaagtaccgcatgatcctgtcagtaaatattgcagattttcaagagaatcagtgggtgacttgtttccaggagtctgctgaagctatccttggacaaaatgctgcttatcttggggaattaaaagacaagaatgaacaggcatttgaagaagttttccagaatgccaacttccgatctttcatattcagagtcagggtcaaagtggagacctacaacgacgagtctcgaattaaggccactgtgatggacgtgaagcccgtggactacagagagtatggccgaaggctggtcatgagcatcaggagaagtgcattgatgtga
Sequence Length
1851
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,138 Da
NCBI Official Full Name
Homo sapiens replication protein A1, 70kDa, mRNA
NCBI Official Synonym Full Names
replication protein A1
NCBI Official Symbol
RPA1
NCBI Official Synonym Symbols
HSSB; RF-A; RP-A; REPA1; RPA70; MST075
NCBI Protein Information
replication protein A 70 kDa DNA-binding subunit
UniProt Protein Name
Replication protein A 70 kDa DNA-binding subunit
Protein Family
UniProt Gene Name
RPA1
UniProt Synonym Gene Names
REPA1; RPA70; RP-A p70; RF-A protein 1
UniProt Entry Name
RFA1_HUMAN

Uniprot Description

RPA1: Plays an essential role in several cellular processes in DNA metabolism including replication, recombination and DNA repair. Binds and subsequently stabilizes single-stranded DNA intermediates and thus prevents complementary DNA from reannealing. Heterotrimer composed of RPA1, RPA2 and RPA3 (canonical replication protein A complex). Component of the alternative replication protein A complex (aRPA) composed of RPA1, RPA3 and RPA4. The DNA-binding activity may reside exclusively on the RPA1 subunit. Interacts with RIPK1 and XPA. Interacts with RPA4. Interacts with the polymerase alpha subunit POLA1/p180; this interaction stabilizes the replicative complex and reduces the misincorporation rate of DNA polymerase alpha by acting as a fidelity clamp. Interact with RAD51 and SENP6 to regulate DNA repair. Interacts with HELB; this interaction promotes HELB recruitement to chromatin following DNA damage. Belongs to the replication factor A protein 1 family.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 17p13.3

Cellular Component: DNA replication factor A complex; nuclear chromosome, telomeric region; nucleoplasm; nucleus; PML body

Molecular Function: damaged DNA binding; protein binding; single-stranded DNA binding

Biological Process: base-excision repair; bypass DNA synthesis; DNA damage response, detection of DNA damage; DNA recombination; DNA repair; DNA replication; DNA-dependent DNA replication; double-strand break repair via homologous recombination; error-prone postreplication DNA repair; G1/S transition of mitotic cell cycle; mismatch repair; nucleotide-excision repair; nucleotide-excision repair, DNA gap filling; nucleotide-excision repair, DNA incision; nucleotide-excision repair, DNA incision, 3'-to lesion; nucleotide-excision repair, DNA incision, 5'-to lesion; nucleotide-excision repair, preincision complex assembly; nucleotide-excision repair, preincision complex stabilization; protein sumoylation; telomere maintenance; telomere maintenance via recombination; transcription-coupled nucleotide-excision repair

Research Articles on RPA1

Similar Products

Product Notes

The RPA1 rpa1 (Catalog #AAA1269097) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcggcc aactgagcga gggggccatt gcggccatca tgcagaaggg ggatacaaac ataaagccca tcctccaagt catcaacatc cgtcccatta ctacggggaa tagtccgccg cgttatcgac tgctcatgag tgatggattg aacactctat cctctttcat gttggcgaca cagttgaacc ctctcgtgga ggaagaacaa ttgtccagca actgtgtatg ccagattcac agatttattg tgaacactct gaaagacgga aggagagtag ttatcttgat ggaattagaa gttttgaagt cagctgaagc agttggagtg aagattggca atccagtgcc ctataatgaa ggactcgggc agccgcaagt agctcctcca gcgccagcag ccagcccagc agcaagcagc aggccccagc cgcagaatgg aagctcggga atgggttcta ctgtttctaa ggcttatggt gcttcaaaga catttggaaa agctgcaggt cccagcctgt cacacacttc tgggggaaca cagtccaaag tggtgcccat tgccagcctc actccttacc agtccaagtg gaccatttgt gctcgtgtta ccaacaaaag tcagatccgt acctggagca actcccgagg ggaagggaag cttttctccc tagaactggt tgacgaaagt ggtgaaatcc gagctacagc tttcaatgag caagtggaca agttctttcc tcttattgaa gtgaacaagg tgtattattt ctcgaaaggc accctgaaga ttgctaacaa gcagttcaca gctgttaaaa atgactacga gatgaccttc aataacgaga cttccgtcat gccctgtgag gacgaccatc atttacctac ggttcagttt gatttcacgg ggattgatga cctcgagaac aagtcgaaag actcacttgt agacatcatc gggatctgca agagctatga agacgccact aaaatcacag tgaggtctaa caacagagaa gttgccaaga ggaatatcta cttgatggac acatctggga aggtggtgac tgctacactg tggggggaag atgctgataa atttgatggt tctagacagc ccgtgttggc tatcaaagga gcccgagtct ctgatttcgg tggacggagc ctctccgtgc tgtcttcaag cactatcatt gcgaatcctg acatcccaga ggcctataag cttcgtggat ggtttgacgc agaaggacaa gccttagatg gtgtttccat ctctgatcta aagagcggcg gagtcggagg gagtaacacc aactggaaaa ccttgtatga ggtcaaatcc gagaacctgg gccaaggcga caagccggac tactttagtt ctgtggccac agtggtgtat cttcgcaaag agaactgcat gtaccaagcc tgcccgactc aggactgcaa taagaaagtg attgatcaac agaatggatt gtaccgctgt gagaagtgcg acaccgaatt tcccaatttc aagtaccgca tgatcctgtc agtaaatatt gcagattttc aagagaatca gtgggtgact tgtttccagg agtctgctga agctatcctt ggacaaaatg ctgcttatct tggggaatta aaagacaaga atgaacaggc atttgaagaa gttttccaga atgccaactt ccgatctttc atattcagag tcagggtcaa agtggagacc tacaacgacg agtctcgaat taaggccact gtgatggacg tgaagcccgt ggactacaga gagtatggcc gaaggctggt catgagcatc aggagaagtg cattgatgtg a. It is sometimes possible for the material contained within the vial of "RPA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.