ZDHHC5 cdna clone

ZDHHC5 cDNA Clone

Gene Names

ZDHHC5; DHHC5; ZNF375

Synonyms

ZDHHC5; ZDHHC5 cDNA Clone; ZDHHC5 cdna clone

Ordering
Cat. Num. AAA1269092 For Research Use Only!

Sequence

atgtttctctttgtgttggccaacttcagcatggccaccttcatggacccagggattttccctcgagctgaggaggatgaggacaaggaagatgatttccgagctcccctttacaaaacagtggagataaagggcatccaggtgcgcatgaaatggtgtgccacctgccgcttttaccgtccccctcgatgttcccactgcagtgtctgtgacaactgtgtggaggaatttgatcatcactgcccctgggtgaataactgtattggtcgccggaactaccgttattttttccttttcctcctttccctgacagcccacattatgggtgtgtttggctttggcctcctttatgtcctctaccacatagaggaactctcaggggtccgcacggctgtcacaatggcagtaatgtgtgtggctggcttattcttcatccctgtagctggcctcacgggatttcacgtggttctggtggccaggggacgcacaaccaatgaacaggttacgggtaaattccggggaggtgtgaaccccttcaccaatggctgctgtaacaatgtcagccgtgttctctgcagttctccagcacccaggtatttggggagaccaaagaaagagaagacaattgtaatcagacctcccttccttcgaccagaagtttcagatgggcagataactgtgaagatcatggataatggcatccagggagagctgaggagaacaaagtctaagggaagcctggagataacagagagccagtctgcagatgctgaacctccacctcctcctaagccagacctgagccgttacacagggttgcgaacacacctcggcctggctactaatgaggatagtagcttattggccaaggacagccccccgacacctaccatgtacaagtatcggccgggttacagtagcagcagtacgtcagctgccatgccgcattcctccagcgccaagttgagtcgtggggacagcttgaaggagccaacctcaattgcagagagcagccgtcaccccagctaccgctcagagcccagcttggaaccagagagcttccgttctcctacctttggcaaaagttttcacttcgatccactatccagtggctcacgctcctccagcctcaagtcagcccagggcacaggctttgagctgggccagttgcaatccattcgttcagagggcaccacctccacctcctataagagcctggccaaccagacacgcaatggaagcctatcttatgacagcttgctcacaccttcagacagccctgattttgagtcagtgcaggcagggcctgagccagacccacctttaggctatacctctcctttcctgtcagccaggctggcccagcaacgggaagctgagaggcacccacgtttggtgccaactggcccaacacaccgagagccctcaccagtccgttacgacaatctgtcgcgccacattgtggcctctctccaggaacgagagaagttgctgcgccagtcacccccactcccgggccgtgaggaagaaccaggcttgggggactcaggcattcagtcaacaccaggctcgggccatgcccctcgtactagttcctcctcagatgattcaaagagatcacctttgggcaagactccactgggacgcccagctgtcccccgttttggcaagccagatgggctaaggggccggggagtagggtcccctgaaccaggcccaacagccccatacctgggccgatcgatgtcttacagcagccaaaaagcccaacctggtgtctctgagacagaagaagtggccttgcagccattactgacacccaaagatgaagtacagctgaagaccacctacagcaaatccaacgggcagcccaagagcttaggctcagcctcccctggcccaggccagccacctctcagtagccccacgaggggaggagtcaagaaggtgtcaggggttggtggtaccacctatgagatttcggtgtga

Sequence Length

1989

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

20071598

NCBI GeneID

25921

Molecular Weight

71,952 Da

NCBI Official Full Name

Homo sapiens zinc finger, DHHC-type containing 5, mRNA

NCBI Official Synonym Full Names

zinc finger DHHC-type containing 5

NCBI Official Symbol

ZDHHC5

NCBI Official Synonym Symbols

DHHC5; ZNF375

NCBI Protein Information

palmitoyltransferase ZDHHC5

UniProt Protein Name

Palmitoyltransferase ZDHHC5

Protein Family

Palmitoyltransferase

UniProt Gene Name

ZDHHC5

UniProt Synonym Gene Names

KIAA1748; ZNF375; DHHC-5

UniProt Entry Name

ZDHC5_HUMAN

Uniprot Description

ZDHHC5: Palmitoyl acyltransferase for the G-protein coupled receptor SSTR5. Also palmitoylates FLOT2. Belongs to the DHHC palmitoyltransferase family. ERF2/ZDHHC9 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.3.1.225; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q12.1

Cellular Component: cytoplasm; membrane; plasma membrane

Molecular Function: palmitoyltransferase activity

Biological Process: protein palmitoylation

Research Articles on ZDHHC5

1. Data indicate that DHHC5 has oncogenic capacity and contributes to tumor formation in non-small cell lung cancer.

Similar Products

Product Notes

The ZDHHC5 zdhhc5 (Catalog #AAA1269092) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttctct ttgtgttggc caacttcagc atggccacct tcatggaccc agggattttc cctcgagctg aggaggatga ggacaaggaa gatgatttcc gagctcccct ttacaaaaca gtggagataa agggcatcca ggtgcgcatg aaatggtgtg ccacctgccg cttttaccgt ccccctcgat gttcccactg cagtgtctgt gacaactgtg tggaggaatt tgatcatcac tgcccctggg tgaataactg tattggtcgc cggaactacc gttatttttt ccttttcctc ctttccctga cagcccacat tatgggtgtg tttggctttg gcctccttta tgtcctctac cacatagagg aactctcagg ggtccgcacg gctgtcacaa tggcagtaat gtgtgtggct ggcttattct tcatccctgt agctggcctc acgggatttc acgtggttct ggtggccagg ggacgcacaa ccaatgaaca ggttacgggt aaattccggg gaggtgtgaa ccccttcacc aatggctgct gtaacaatgt cagccgtgtt ctctgcagtt ctccagcacc caggtatttg gggagaccaa agaaagagaa gacaattgta atcagacctc ccttccttcg accagaagtt tcagatgggc agataactgt gaagatcatg gataatggca tccagggaga gctgaggaga acaaagtcta agggaagcct ggagataaca gagagccagt ctgcagatgc tgaacctcca cctcctccta agccagacct gagccgttac acagggttgc gaacacacct cggcctggct actaatgagg atagtagctt attggccaag gacagccccc cgacacctac catgtacaag tatcggccgg gttacagtag cagcagtacg tcagctgcca tgccgcattc ctccagcgcc aagttgagtc gtggggacag cttgaaggag ccaacctcaa ttgcagagag cagccgtcac cccagctacc gctcagagcc cagcttggaa ccagagagct tccgttctcc tacctttggc aaaagttttc acttcgatcc actatccagt ggctcacgct cctccagcct caagtcagcc cagggcacag gctttgagct gggccagttg caatccattc gttcagaggg caccacctcc acctcctata agagcctggc caaccagaca cgcaatggaa gcctatctta tgacagcttg ctcacacctt cagacagccc tgattttgag tcagtgcagg cagggcctga gccagaccca cctttaggct atacctctcc tttcctgtca gccaggctgg cccagcaacg ggaagctgag aggcacccac gtttggtgcc aactggccca acacaccgag agccctcacc agtccgttac gacaatctgt cgcgccacat tgtggcctct ctccaggaac gagagaagtt gctgcgccag tcacccccac tcccgggccg tgaggaagaa ccaggcttgg gggactcagg cattcagtca acaccaggct cgggccatgc ccctcgtact agttcctcct cagatgattc aaagagatca cctttgggca agactccact gggacgccca gctgtccccc gttttggcaa gccagatggg ctaaggggcc ggggagtagg gtcccctgaa ccaggcccaa cagccccata cctgggccga tcgatgtctt acagcagcca aaaagcccaa cctggtgtct ctgagacaga agaagtggcc ttgcagccat tactgacacc caaagatgaa gtacagctga agaccaccta cagcaaatcc aacgggcagc ccaagagctt aggctcagcc tcccctggcc caggccagcc acctctcagt agccccacga ggggaggagt caagaaggtg tcaggggttg gtggtaccac ctatgagatt tcggtgtga. It is sometimes possible for the material contained within the vial of "ZDHHC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ZDHHC5 cdna clone