Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGED1 cdna clone

MAGED1 cDNA Clone

Gene Names
MAGED1; NRAGE; DLXIN-1
Synonyms
MAGED1; MAGED1 cDNA Clone; MAGED1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcagaaaatggactgtggtgcgggcctcctcggcttccaggctgaggcctccgtagaagacagcgccttgcttatgcagaccttgatggaggccatccagatctcagaggctccacctactaaccaggccaccgcagctgctagtccccagagttcacagcccccaactgccaatgagatggctgacattcaggtttcagcagctgccgctaggcctaagtcagcctttaaagtccagaatgccaccacaaaaggcccaaatggtgtctatgatttctctcaggctcataatgccaaggatgtgcccaacacgcagcccaaggcagcctttaagtcccaaaatgctaccccaaagggtccaaatgctgcctatgatttttcccaggcagcaaccactggtgagttagctgctaacaagtctgagatggccttcaaggcccagaatgccactactaaagtgggcccaaatgccacctacaatttctctcagtctctcaatgccaatgacctggccaacagcaggcctaagacccctttcaaggcttggaatgataccactaaggccccaacagctgatacccagacccagaatgtaaatcaggccaaaatggccacttcccaggctgacatagagaccgacccaggtatctctgaacctgacggtgcaactgcacagacatcagcagatggttcccaggctcagaatctggagtcccggacaataattcggggcaagaggacccgcaagattaataacttgaatgttgaagagaacagcagtggggatcagaggcgggccccactggctgcagggacctggaggtctgcaccagttccagtgaccactcagaacccacctggcgcaccccccaatgtgctctggcagacgccattggcttggcagaacccctcaggctggcaaaaccagacagccaggcagaccccaccagcacgtcagagccctccagctaggcagaccccaccagcctggcagaacccagtcgcttggcagaacccagtgatttggccaaacccagtaatctggcagaacccagtgatctggccaaaccccattgtctggcccggccctgttgtctggccgaatccactggcctggcagaatccacctggatggcagactccacctggatggcagaccccaccgggctggcagggtcctccagactggcaaggtcctcctgactggccgctaccacccgactggccactgccacctgattggccacttcccactgactggccactaccacctgactggatccccgctgattggccaattccacctgactggcagaacctgcgcccctcgcctaacctgcgcccttctcccaactcgcgtgcctcacagaacccaggtgctgcacagccccgagatgtggcccttcttcaggaaagagcaaataagttggtcaagtacttgatgcttaaggactacacaaaggtgcccatcaagcgctcagaaatgctgagagatatcatccgtgaatacactgatgtttatccagaaatcattgaacgtgcatgctttgtcctagagaagaaatttgggattcaactgaaagaaattgacaaagaagaacacctgtatattctcatcagtacccccgagtccctggctggcatactgggaacgaccaaagacacacccaagctcggtctcctcttggtgattctgggtgtcatcttcatgaatggcaaccgtgccagtgaggctgtcctctgggaggcactacgcaagatgggactgcgtcctggggtgagacatcccctccttggagatctaaggaaacttctcacctatgagtttgtaaagcagaaatacctggactacagacgagtgcccaacagcaaccccccggagtatgagttcctctggggcctccgttcctaccatgagactagcaagatgaaagtgctgagattcattgcagaggttcagaaaagagaccctcgtgactggactgcacagttcatggaggctgcagatgaggccttggatgctctggatgctgctgcagctgaggccgaagcccgggctgaagcaagaacccgcatgggaattggagatgaggctgtgtctgggccctggagctgggatgacattgagtttgagctgctgacctgggatgaggaaggagattttggagatccctggtccagaattccatttaccttctgggccagataccaccagaatgcccgctccagattccctcagacctttgccggtcccattattggtcctggtggtacagccagtgccaacttcgctgccaactttggtgccattggtttcttctgggttgagtga
Sequence Length
2337
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
91,959 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family D, 1, mRNA
NCBI Official Synonym Full Names
MAGE family member D1
NCBI Official Symbol
MAGED1
NCBI Official Synonym Symbols
NRAGE; DLXIN-1
NCBI Protein Information
melanoma-associated antigen D1
UniProt Protein Name
Melanoma-associated antigen D1
UniProt Gene Name
MAGED1
UniProt Synonym Gene Names
NRAGE
UniProt Entry Name
MAGD1_HUMAN

NCBI Description

This gene is a member of the melanoma antigen gene (MAGE) family. Most of the genes of this family encode tumor specific antigens that are not expressed in normal adult tissues except testis. Although the protein encoded by this gene shares strong homology with members of the MAGE family, it is expressed in almost all normal adult tissues. This gene has been demonstrated to be involved in the p75 neurotrophin receptor mediated programmed cell death pathway. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

NRAGE: a member of the melanoma antigen gene (MAGE) family. Most of the genes of this family encode tumor specific antigens that are not expressed in normal adult tissues except testis. Although NRAGE shares strong homology with members of the MAGE family, it is expressed in almost all normal adult tissues. Binds p75 neurotrophin receptor (p75NTR) and antagonizes its association with TrkA, inhibits cell cycle progression, and facilitates p75NTR-mediated apoptosis. May act as a regulator of the function of DLX family members.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: chromatin; nucleus; protein complex

Molecular Function: protein binding

Biological Process: circadian regulation of gene expression; negative regulation of epithelial cell proliferation; regulation of apoptosis; regulation of transcription, DNA-dependent

Research Articles on MAGED1

Similar Products

Product Notes

The MAGED1 maged1 (Catalog #AAA1268909) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcaga aaatggactg tggtgcgggc ctcctcggct tccaggctga ggcctccgta gaagacagcg ccttgcttat gcagaccttg atggaggcca tccagatctc agaggctcca cctactaacc aggccaccgc agctgctagt ccccagagtt cacagccccc aactgccaat gagatggctg acattcaggt ttcagcagct gccgctaggc ctaagtcagc ctttaaagtc cagaatgcca ccacaaaagg cccaaatggt gtctatgatt tctctcaggc tcataatgcc aaggatgtgc ccaacacgca gcccaaggca gcctttaagt cccaaaatgc taccccaaag ggtccaaatg ctgcctatga tttttcccag gcagcaacca ctggtgagtt agctgctaac aagtctgaga tggccttcaa ggcccagaat gccactacta aagtgggccc aaatgccacc tacaatttct ctcagtctct caatgccaat gacctggcca acagcaggcc taagacccct ttcaaggctt ggaatgatac cactaaggcc ccaacagctg atacccagac ccagaatgta aatcaggcca aaatggccac ttcccaggct gacatagaga ccgacccagg tatctctgaa cctgacggtg caactgcaca gacatcagca gatggttccc aggctcagaa tctggagtcc cggacaataa ttcggggcaa gaggacccgc aagattaata acttgaatgt tgaagagaac agcagtgggg atcagaggcg ggccccactg gctgcaggga cctggaggtc tgcaccagtt ccagtgacca ctcagaaccc acctggcgca ccccccaatg tgctctggca gacgccattg gcttggcaga acccctcagg ctggcaaaac cagacagcca ggcagacccc accagcacgt cagagccctc cagctaggca gaccccacca gcctggcaga acccagtcgc ttggcagaac ccagtgattt ggccaaaccc agtaatctgg cagaacccag tgatctggcc aaaccccatt gtctggcccg gccctgttgt ctggccgaat ccactggcct ggcagaatcc acctggatgg cagactccac ctggatggca gaccccaccg ggctggcagg gtcctccaga ctggcaaggt cctcctgact ggccgctacc acccgactgg ccactgccac ctgattggcc acttcccact gactggccac taccacctga ctggatcccc gctgattggc caattccacc tgactggcag aacctgcgcc cctcgcctaa cctgcgccct tctcccaact cgcgtgcctc acagaaccca ggtgctgcac agccccgaga tgtggccctt cttcaggaaa gagcaaataa gttggtcaag tacttgatgc ttaaggacta cacaaaggtg cccatcaagc gctcagaaat gctgagagat atcatccgtg aatacactga tgtttatcca gaaatcattg aacgtgcatg ctttgtccta gagaagaaat ttgggattca actgaaagaa attgacaaag aagaacacct gtatattctc atcagtaccc ccgagtccct ggctggcata ctgggaacga ccaaagacac acccaagctc ggtctcctct tggtgattct gggtgtcatc ttcatgaatg gcaaccgtgc cagtgaggct gtcctctggg aggcactacg caagatggga ctgcgtcctg gggtgagaca tcccctcctt ggagatctaa ggaaacttct cacctatgag tttgtaaagc agaaatacct ggactacaga cgagtgccca acagcaaccc cccggagtat gagttcctct ggggcctccg ttcctaccat gagactagca agatgaaagt gctgagattc attgcagagg ttcagaaaag agaccctcgt gactggactg cacagttcat ggaggctgca gatgaggcct tggatgctct ggatgctgct gcagctgagg ccgaagcccg ggctgaagca agaacccgca tgggaattgg agatgaggct gtgtctgggc cctggagctg ggatgacatt gagtttgagc tgctgacctg ggatgaggaa ggagattttg gagatccctg gtccagaatt ccatttacct tctgggccag ataccaccag aatgcccgct ccagattccc tcagaccttt gccggtccca ttattggtcc tggtggtaca gccagtgcca acttcgctgc caactttggt gccattggtt tcttctgggt tgagtga. It is sometimes possible for the material contained within the vial of "MAGED1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.