C19orf66 cdna clone
C19orf66 cDNA Clone
Gene Names
C19orf66; RyDEN
Synonyms
C19orf66; C19orf66 cDNA Clone; C19orf66 cdna clone
Sequence
atgtctcaggaaggtgtggagctggagaagagcgtccggcgcctccgggagaagtttcatgggaaggtatcctccaagaaggcgggggctctgatgaggaaattcggcagcgaccacacgggagtggggcgctccatcgtgtacggggtaaagcaaaaagatggccaagaactaagtaacgatctggatgcccaggatccaccagaagatatgaagcaggaccgggacattcaggcagtggcgacctccctcctgccactgacagaagccaacctacgcatgtttcaacgtgcccaggacgaccttatccctgctgtggaccggcagtttgcctgctcctcctgcgaccacgtctggtggcgccgcgtgccccagcggaaggaggtatcccggtgccggaaatgccggaagcgctacgagccagtgccagctgacaagatgtggggcctggctgagttccactgcccgaagtgtcggcacaacttccgcacccacactcactcctgctcagctgccgactgctacaaccggcgagagccccacgtgcctgggacatcctgtgctcaccccaagagccggaagcagaaccacctgcccaaagtgctccaccccagcaaccctcacattagcagtggctccactgtggccacctgcttgagccagggtggcctcctggaagacctggacaacctcatcctggaggacctgaaggaggaggaggaggaagaggaggaggtggaggacgaggagggcgggcccagggagtga
Sequence Length
768
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,006 Da
NCBI Official Full Name
Homo sapiens chromosome 19 open reading frame 66, mRNA
NCBI Official Synonym Full Names
chromosome 19 open reading frame 66
NCBI Official Symbol
C19orf66
NCBI Official Synonym Symbols
RyDEN
NCBI Protein Information
repressor of yield of DENV protein
UniProt Protein Name
Repressor of yield of DENV protein
UniProt Gene Name
RYDEN
UniProt Synonym Gene Names
RyDEN
UniProt Entry Name
RYDEN_HUMAN
Uniprot Description
C19orf66: Belongs to the UPF0515 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 19p13.2
Cellular Component: cytoplasm; nucleus
Molecular Function: protein binding; RNA binding
Biological Process: defense response to virus; negative regulation of viral genome replication
Research Articles on C19orf66
Similar Products
Product Notes
The C19orf66 ryden (Catalog #AAA1268841) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcagg aaggtgtgga gctggagaag agcgtccggc gcctccggga gaagtttcat gggaaggtat cctccaagaa ggcgggggct ctgatgagga aattcggcag cgaccacacg ggagtggggc gctccatcgt gtacggggta aagcaaaaag atggccaaga actaagtaac gatctggatg cccaggatcc accagaagat atgaagcagg accgggacat tcaggcagtg gcgacctccc tcctgccact gacagaagcc aacctacgca tgtttcaacg tgcccaggac gaccttatcc ctgctgtgga ccggcagttt gcctgctcct cctgcgacca cgtctggtgg cgccgcgtgc cccagcggaa ggaggtatcc cggtgccgga aatgccggaa gcgctacgag ccagtgccag ctgacaagat gtggggcctg gctgagttcc actgcccgaa gtgtcggcac aacttccgca cccacactca ctcctgctca gctgccgact gctacaaccg gcgagagccc cacgtgcctg ggacatcctg tgctcacccc aagagccgga agcagaacca cctgcccaaa gtgctccacc ccagcaaccc tcacattagc agtggctcca ctgtggccac ctgcttgagc cagggtggcc tcctggaaga cctggacaac ctcatcctgg aggacctgaa ggaggaggag gaggaagagg aggaggtgga ggacgaggag ggcgggccca gggagtga. It is sometimes possible for the material contained within the vial of "C19orf66, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
