Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNX18 cdna clone

SNX18 cDNA Clone

Gene Names
SNX18; SNAG1; SH3PX2; SH3PXD3B
Synonyms
SNX18; SNX18 cDNA Clone; SNX18 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgcgcgcccgggcgctgtacgacttcaggtcggagaacccaggagagatctcgctgcgagagcacgaggtgctgagcctgtgcagcgagcaggacatcgagggctggctcgagggggtcaacagccgcggcgaccgcggcctcttcccggcctcctatgtgcaggtgatccgcgcccccgagcctggcccggcgggagacggcggcccgggcgccccggcccgctacgccaatgtgccccccgggggcttcgagcccctgcccgtcgcgccccccgcctccttcaagccgccgcctgacgccttccaggcgctgctgcagccacagcaggcgccgcctccgagcaccttccagccgcccggcgcgggcttcccgtacggcgggggcgccctgcagccgtcgcctcagcagctctacggcggctaccaggccagccaaggcagcgatgatgactgggacgacgagtgggacgacagctccacggtggcggacgagccgggcgctctgggcagcggagcatacccggacctcgacggctcgtcttcggcgggtgtgggcgcagccggccgctaccgcctgtccacgcgctccgacctgtccctgggctcccgcggcggctcggtccccccgcagcaccacccgtcggggcccaagagctcggccaccgtgagccgcaacctcaatcgcttctccaccttcgtcaagtccggcggggaggccttcgtgctgggggaggcgtcaggcttcgtgaaggacggggacaagctgtgcgtggtgctggggccctatggccccgagtggcaggagaacccctacccgttccagtgcaccatcgacgaccccaccaagcagaccaagttcaagggcatgaagagctacatctcctacaagctggtgcccacgcacacgcaggtgccggtgcatcggcgctacaagcacttcgactggctgtacgcgcgcctggcggagaagttcccggtcatctccgtgccccacctgcccgagaagcaggccaccggccgcttcgaggaggacttcatctctaagcgcaggaagggcctgatctggtggatgaaccacatggccagccacccagtgctggcgcagtgcgacgtcttccagcacttcctgacgtgccccagcagcaccgacgagaaagcctggaagcagggcaagaggaaggccgagaaggacgagatggtgggcgccaacttcttcctgacccttagcacgccccccgccgctgcccttgacctgcaggaggtggagagcaagatcgacggcttcaagtgcttcaccaagaagatggacgacagcgcgctgcagctcaaccacacggccaacgagttcgcgcgcaagcaggtgaccggcttcaaaaaggagtatcagaaggtgggccagtccttccgcggcctcagccaggcctttgagctggaccagcaggccttctcggtgggcctgaaccaggctatcgccttcaccggagatgcctatgacgccattggcgagctcttcgcggagcagcccaggcaggacctggatcccgtcatggacctattagcgctgtatcaggggcatctggctaacttcccggacatcatccacgttcagaaaggtaaagcctggcccttagagcaggtgatatggagtgtattgtgcaggctgaaaggggcgactttgacagcagtaccactgtgggtttcagaatcatattctacaggtgaggaagcgagcagagacgtggacgcctgggtcttttccctagagtgtacgttggattgctcgacaggcagcttcctcctcgagtatcttgcattagggaatgagtactctttctcgaaggttcaaagagtacctttgatgacagtgctatcattttag
Sequence Length
1887
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,752 Da
NCBI Official Full Name
Homo sapiens sorting nexin 18, mRNA
NCBI Official Synonym Full Names
sorting nexin 18
NCBI Official Symbol
SNX18
NCBI Official Synonym Symbols
SNAG1; SH3PX2; SH3PXD3B
NCBI Protein Information
sorting nexin-18
UniProt Protein Name
Sorting nexin-18
Protein Family
UniProt Gene Name
SNX18
UniProt Synonym Gene Names
SH3PXD3B; SNAG1
UniProt Entry Name
SNX18_HUMAN

NCBI Description

This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SNX18: May be involved in several stages of intracellular trafficking. Plays a role in endocytosis via clathrin-coated pits, but also clathrin-independent, actin-dependent fluid-phase endocytosis. Plays a role in macropinocytosis. Binds to membranes enriched in phosphatidylinositol 4,5-bisphosphate and promotes membrane tubulation. Stimulates the GTPase activity of DNM2. Promotes DNM2 location at the plasma membrane. Belongs to the sorting nexin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 5q11.2

Cellular Component: clathrin-coated vesicle; cytoplasmic membrane-bound vesicle; endosome; extrinsic to internal side of plasma membrane; intracellular membrane-bound organelle; nucleoplasm

Molecular Function: phosphatidylinositol-4,5-bisphosphate binding; protein binding

Biological Process: cytokinesis after mitosis; endocytosis; endosome transport; positive regulation of GTPase activity; vesicle organization and biogenesis

Research Articles on SNX18

Similar Products

Product Notes

The SNX18 snx18 (Catalog #AAA1268812) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgc gcgcccgggc gctgtacgac ttcaggtcgg agaacccagg agagatctcg ctgcgagagc acgaggtgct gagcctgtgc agcgagcagg acatcgaggg ctggctcgag ggggtcaaca gccgcggcga ccgcggcctc ttcccggcct cctatgtgca ggtgatccgc gcccccgagc ctggcccggc gggagacggc ggcccgggcg ccccggcccg ctacgccaat gtgccccccg ggggcttcga gcccctgccc gtcgcgcccc ccgcctcctt caagccgccg cctgacgcct tccaggcgct gctgcagcca cagcaggcgc cgcctccgag caccttccag ccgcccggcg cgggcttccc gtacggcggg ggcgccctgc agccgtcgcc tcagcagctc tacggcggct accaggccag ccaaggcagc gatgatgact gggacgacga gtgggacgac agctccacgg tggcggacga gccgggcgct ctgggcagcg gagcataccc ggacctcgac ggctcgtctt cggcgggtgt gggcgcagcc ggccgctacc gcctgtccac gcgctccgac ctgtccctgg gctcccgcgg cggctcggtc cccccgcagc accacccgtc ggggcccaag agctcggcca ccgtgagccg caacctcaat cgcttctcca ccttcgtcaa gtccggcggg gaggccttcg tgctggggga ggcgtcaggc ttcgtgaagg acggggacaa gctgtgcgtg gtgctggggc cctatggccc cgagtggcag gagaacccct acccgttcca gtgcaccatc gacgacccca ccaagcagac caagttcaag ggcatgaaga gctacatctc ctacaagctg gtgcccacgc acacgcaggt gccggtgcat cggcgctaca agcacttcga ctggctgtac gcgcgcctgg cggagaagtt cccggtcatc tccgtgcccc acctgcccga gaagcaggcc accggccgct tcgaggagga cttcatctct aagcgcagga agggcctgat ctggtggatg aaccacatgg ccagccaccc agtgctggcg cagtgcgacg tcttccagca cttcctgacg tgccccagca gcaccgacga gaaagcctgg aagcagggca agaggaaggc cgagaaggac gagatggtgg gcgccaactt cttcctgacc cttagcacgc cccccgccgc tgcccttgac ctgcaggagg tggagagcaa gatcgacggc ttcaagtgct tcaccaagaa gatggacgac agcgcgctgc agctcaacca cacggccaac gagttcgcgc gcaagcaggt gaccggcttc aaaaaggagt atcagaaggt gggccagtcc ttccgcggcc tcagccaggc ctttgagctg gaccagcagg ccttctcggt gggcctgaac caggctatcg ccttcaccgg agatgcctat gacgccattg gcgagctctt cgcggagcag cccaggcagg acctggatcc cgtcatggac ctattagcgc tgtatcaggg gcatctggct aacttcccgg acatcatcca cgttcagaaa ggtaaagcct ggcccttaga gcaggtgata tggagtgtat tgtgcaggct gaaaggggcg actttgacag cagtaccact gtgggtttca gaatcatatt ctacaggtga ggaagcgagc agagacgtgg acgcctgggt cttttcccta gagtgtacgt tggattgctc gacaggcagc ttcctcctcg agtatcttgc attagggaat gagtactctt tctcgaaggt tcaaagagta cctttgatga cagtgctatc attttag. It is sometimes possible for the material contained within the vial of "SNX18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.