Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS3 cdna clone

RGS3 cDNA Clone

Gene Names
RGS3; C2PA; RGP3
Synonyms
RGS3; RGS3 cDNA Clone; RGS3 cdna clone
Ordering
For Research Use Only!
Sequence
atgctccgaggcatgtacctcactcgcaacgggaacctgcagaggcgacacacgatgaaggaagccaaggacatgaagaacaagctggggatcttcagacggcggagtgagtcccctggagcccctcccgcgggcaaggcagacaaaatgatgaagtcattcaagcccacctcagaggaagccctcaagtggggcgagtccttggagaagctgctggttcacaaatacgggttagcagtgttccaagccttccttcgcactgagttcagtgaggagaatctggagttctggttggcttgtgaggacttcaagaaggtcaagtcacagtccaagatggcatccaaggccaagaagatctttgctgaatacatcgcgatccaggcatgcaaggaggtcaacctggactcctacacgcgggagcacaccaaggacaacctgcagagcgtcacgcggggctgcttcgacctggcacagaagcgcatcttcgggctcatggaaaaggactcgtaccctcgctttctccgttctgacctctacctggaccttattaaccagaagaagatgagtcccccgctttag
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,478 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 3, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 3
NCBI Official Symbol
RGS3
NCBI Official Synonym Symbols
C2PA; RGP3
NCBI Protein Information
regulator of G-protein signaling 3
UniProt Protein Name
Regulator of G-protein signaling 3
UniProt Gene Name
RGS3
UniProt Synonym Gene Names
RGP3; RGS3
UniProt Entry Name
RGS3_HUMAN

NCBI Description

This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]

Uniprot Description

RGS3: Down-regulates signaling from heterotrimeric G-proteins by increasing the GTPase activity of the alpha subunits, thereby driving them into their inactive GDP-bound form. Down-regulates G- protein-mediated release of inositol phosphates and activation of MAP kinases. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs, RGS; GAPs

Chromosomal Location of Human Ortholog: 9q32

Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane

Molecular Function: GTPase activator activity; protein binding

Biological Process: inactivation of MAPK activity; regulation of G-protein coupled receptor protein signaling pathway

Research Articles on RGS3

Similar Products

Product Notes

The RGS3 rgs3 (Catalog #AAA1268763) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctccgag gcatgtacct cactcgcaac gggaacctgc agaggcgaca cacgatgaag gaagccaagg acatgaagaa caagctgggg atcttcagac ggcggagtga gtcccctgga gcccctcccg cgggcaaggc agacaaaatg atgaagtcat tcaagcccac ctcagaggaa gccctcaagt ggggcgagtc cttggagaag ctgctggttc acaaatacgg gttagcagtg ttccaagcct tccttcgcac tgagttcagt gaggagaatc tggagttctg gttggcttgt gaggacttca agaaggtcaa gtcacagtcc aagatggcat ccaaggccaa gaagatcttt gctgaataca tcgcgatcca ggcatgcaag gaggtcaacc tggactccta cacgcgggag cacaccaagg acaacctgca gagcgtcacg cggggctgct tcgacctggc acagaagcgc atcttcgggc tcatggaaaa ggactcgtac cctcgctttc tccgttctga cctctacctg gaccttatta accagaagaa gatgagtccc ccgctttag. It is sometimes possible for the material contained within the vial of "RGS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.