ETS2 cdna clone
ETS2 cDNA Clone
Gene Names
ETS2; ETS2IT1
Synonyms
ETS2; ETS2 cDNA Clone; ETS2 cdna clone
Sequence
atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattccatttctcatgactccgccaactgtgaattgcctttgttaaccccgtgcagcaaggctgtgatgagtcaagccttaaaagctaccttcagtggcttcaaaaaggaacagcggcgcctgggcattccaaagaacccctggctgtggagtgagcaacaggtatgccagtggcttctctgggccaccaatgagttcagtctggtgaacgtgaatctgcagaggttcggcatgaatggccagatgctgtgtaaccttggcaaggaacgctttctggagctggcacctgactttgtgggtgacattctctgggaacatctggagcaaatgatcaaagaaaaccaagaaaagacagaagatcaatatgaagaaaattcacacctcacctccgttcctcattggattaacagcaatacattaggttttggcacagagcaggcgccctatggaatgcagacacagaattaccccaaaggcggcctcctggacagcatgtgtccggcctccacacccagcgtactcagctctgagcaggagtttcagatgttccccaagtctcggctcagctccgtcagcgtcacctactgctctgtcagtcaggacttcccaggcagcaacttgaatttgctcaccaacaattctgggacgcccaaagaccacgactcccctgagaacggtgcggacagcttcgagagctcagactccctcctccagtcctggaacagccagtcgtccttgctggatgtgcaacgggttccttccttcgagagcttcgaagatgactgcagccagtctctctgcctcaataagccaaccatgtctttcaaggattacatccaagagaggagtgacccggtggagcaaggcaaaccagttatacctgcagctgtgctggccggcttcacaggaagtggacctattcagctgtggcagtttctcctggagctgctatcagacaaatcctgccagtcattcatcagctggactggagacggatgggagtttaagctcgccgaccccgatgaggtggcccgccggtggggaaagaggaaaaataagcccaagatgaactacgagaagctgagccggggcttacgctactattacgacaagaacatcatccacaagacgtcggggaagcgctacgtgtaccgcttcgtgtgcgacctccagaacttgctggggttcacgcccgaggaactgcacgccatcctgggcgtccagcccgacacggaggactga
Sequence Length
1410
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,001 Da
NCBI Official Full Name
Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 2 (avian), mRNA
NCBI Official Synonym Full Names
ETS proto-oncogene 2, transcription factor
NCBI Official Symbol
ETS2
NCBI Official Synonym Symbols
ETS2IT1
NCBI Protein Information
protein C-ets-2
UniProt Protein Name
Protein C-ets-2
Protein Family
UniProt Gene Name
ETS2
UniProt Entry Name
ETS2_HUMAN
NCBI Description
This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Uniprot Description
Ets-2: a proto-oncogenic transcription factor homologous to the v-ets erythroblastosis virus E26 oncogene. A target of the Akt/JNK signaling pathway in macrophages. A PKC pathway activates ETS2, up-regulating GM-CSF in non-small lung carcinoma cells.
Protein type: Oncoprotein; Transcription factor; DNA-binding
Chromosomal Location of Human Ortholog: 21q22.2
Cellular Component: cytoplasm; nucleoplasm; nucleus; plasma membrane
Molecular Function: DNA binding; protein binding; transcription factor activity
Biological Process: cell differentiation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; skeletal development
Research Articles on ETS2
Similar Products
Product Notes
The ETS2 ets2 (Catalog #AAA1268744) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgatt tcggaatcaa gaatatggac caggtagccc ctgtggctaa cagttacaga gggacactca agcgccagcc agcctttgac acctttgatg ggtccctgtt tgctgttttt ccttctctaa atgaagagca aacactgcaa gaagtgccaa caggcttgga ttccatttct catgactccg ccaactgtga attgcctttg ttaaccccgt gcagcaaggc tgtgatgagt caagccttaa aagctacctt cagtggcttc aaaaaggaac agcggcgcct gggcattcca aagaacccct ggctgtggag tgagcaacag gtatgccagt ggcttctctg ggccaccaat gagttcagtc tggtgaacgt gaatctgcag aggttcggca tgaatggcca gatgctgtgt aaccttggca aggaacgctt tctggagctg gcacctgact ttgtgggtga cattctctgg gaacatctgg agcaaatgat caaagaaaac caagaaaaga cagaagatca atatgaagaa aattcacacc tcacctccgt tcctcattgg attaacagca atacattagg ttttggcaca gagcaggcgc cctatggaat gcagacacag aattacccca aaggcggcct cctggacagc atgtgtccgg cctccacacc cagcgtactc agctctgagc aggagtttca gatgttcccc aagtctcggc tcagctccgt cagcgtcacc tactgctctg tcagtcagga cttcccaggc agcaacttga atttgctcac caacaattct gggacgccca aagaccacga ctcccctgag aacggtgcgg acagcttcga gagctcagac tccctcctcc agtcctggaa cagccagtcg tccttgctgg atgtgcaacg ggttccttcc ttcgagagct tcgaagatga ctgcagccag tctctctgcc tcaataagcc aaccatgtct ttcaaggatt acatccaaga gaggagtgac ccggtggagc aaggcaaacc agttatacct gcagctgtgc tggccggctt cacaggaagt ggacctattc agctgtggca gtttctcctg gagctgctat cagacaaatc ctgccagtca ttcatcagct ggactggaga cggatgggag tttaagctcg ccgaccccga tgaggtggcc cgccggtggg gaaagaggaa aaataagccc aagatgaact acgagaagct gagccggggc ttacgctact attacgacaa gaacatcatc cacaagacgt cggggaagcg ctacgtgtac cgcttcgtgt gcgacctcca gaacttgctg gggttcacgc ccgaggaact gcacgccatc ctgggcgtcc agcccgacac ggaggactga. It is sometimes possible for the material contained within the vial of "ETS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
