Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SDHD cdna clone

SDHD cDNA Clone

Gene Names
SDHD; PGL; CBT1; CWS3; PGL1; QPs3; SDH4; cybS; CII-4
Synonyms
SDHD; SDHD cDNA Clone; SDHD cdna clone
Ordering
For Research Use Only!
Sequence
atggcggttctctggaggctgagtgccgtttgcggtgccctaggaggccgagctctgttgcttcgaactccagtggtcagacctgctcatatctcagcatttcttcaggaccgacctatcccagaatggtgtggagtgcagcacatacacttgtcaccgagccaccattctggctccaaggctgcatctctccactggactagtgagagggttgtcagtgttttgctcctgggtctgcttccggctgcttatttgaatccttgctctgcgatggactattccctggctgcagccctcactcttcatggtcactggggccttggacaagttgttactgactatgttcatggggatgccttgcagaaagctgccaaggcagggcttttggcactttcagctttaacctttgctgggctttgctatttcaactatcacgatgtgggcatctgcaaagctgttgccatgctgtggaagctctga
Sequence Length
480
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,361 Da
NCBI Official Full Name
Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein, mRNA
NCBI Official Synonym Full Names
succinate dehydrogenase complex subunit D
NCBI Official Symbol
SDHD
NCBI Official Synonym Symbols
PGL; CBT1; CWS3; PGL1; QPs3; SDH4; cybS; CII-4
NCBI Protein Information
succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial
UniProt Protein Name
Succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial
Protein Family
UniProt Gene Name
SDHD
UniProt Synonym Gene Names
SDH4; CybS
UniProt Entry Name
DHSD_HUMAN

NCBI Description

This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]

Uniprot Description

SDHD: Membrane-anchoring subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). Defects in SDHD are a cause of paragangliomas type 1 (PGL1). A neural crest tumor usually derived from the chromoreceptor tissue of a paraganglion. PGL1 is a rare autosomal dominant disorder which is characterized by the development of mostly benign, highly vascular, slowly growing tumors in the head and neck. In the head and neck region, the carotid body is the largest of all paraganglia and is also the most common site of the tumors. Defects in SDHD are a cause of susceptibility to pheochromocytoma (PCC). A catecholamine-producing tumor of chromaffin tissue of the adrenal medulla or sympathetic paraganglia. The cardinal symptom, reflecting the increased secretion of epinephrine and norepinephrine, is hypertension, which may be persistent or intermittent. Defects in SDHD may be a cause of susceptibility to intestinal carcinoid tumor (ICT). A yellow, well- differentiated, circumscribed tumor that arises from enterochromaffin cells in the small intestine or, less frequently, in other parts of the gastrointestinal tract. Defects in SDHD are a cause of paraganglioma and gastric stromal sarcoma (PGGSS); also called Carney-Stratakis syndrome. Gastrointestinal stromal tumors may be sporadic or inherited in an autosomal dominant manner, alone or as a component of a syndrome associated with other tumors, such as in the context of neurofibromatosis type 1 (NF1). Patients have both gastrointestinal stromal tumors and paragangliomas. Susceptibility to the tumors was inherited in an apparently autosomal dominant manner, with incomplete penetrance. Defects in SDHD are a cause of Cowden-like syndrome (CWDLS). Cowden-like syndrome is a cancer predisposition syndrome associated with elevated risk for tumors of the breast, thyroid, kidney and uterus. Belongs to the CybS family.

Protein type: Membrane protein, integral; Energy Metabolism - oxidative phosphorylation; Carbohydrate Metabolism - citrate (TCA) cycle; Mitochondrial; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: mitochondrial envelope; mitochondrial inner membrane; mitochondrial respiratory chain complex II; mitochondrion

Molecular Function: electron carrier activity; heme binding; succinate dehydrogenase activity; ubiquinone binding

Biological Process: tricarboxylic acid cycle

Disease: Carcinoid Tumors, Intestinal; Cowden Syndrome 3; Paraganglioma And Gastric Stromal Sarcoma; Paragangliomas 1; Pheochromocytoma

Research Articles on SDHD

Similar Products

Product Notes

The SDHD sdhd (Catalog #AAA1268741) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggttc tctggaggct gagtgccgtt tgcggtgccc taggaggccg agctctgttg cttcgaactc cagtggtcag acctgctcat atctcagcat ttcttcagga ccgacctatc ccagaatggt gtggagtgca gcacatacac ttgtcaccga gccaccattc tggctccaag gctgcatctc tccactggac tagtgagagg gttgtcagtg ttttgctcct gggtctgctt ccggctgctt atttgaatcc ttgctctgcg atggactatt ccctggctgc agccctcact cttcatggtc actggggcct tggacaagtt gttactgact atgttcatgg ggatgccttg cagaaagctg ccaaggcagg gcttttggca ctttcagctt taacctttgc tgggctttgc tatttcaact atcacgatgt gggcatctgc aaagctgttg ccatgctgtg gaagctctga. It is sometimes possible for the material contained within the vial of "SDHD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.