Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD17B2 cdna clone

HSD17B2 cDNA Clone

Gene Names
HSD17B2; HSD17; SDR9C2; EDH17B2
Synonyms
HSD17B2; HSD17B2 cDNA Clone; HSD17B2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcactttcttctcggacacagcatggatctgcctggctgtccccacagtactatgtgggacagtattttgcaaatacaagaagagctcagggcagctgtggagctggatggtctgcctggcaggcctctgtgcagtctgcctgctcatcctgtcccctttttggggcttgatcctcttctcggtgtcatgcttcctcatgtatacttacttatctggccaagaattgttacctgtggatcagaaggcagtcctggtgacaggtggtgattgcgggcttggccatgctttgtgcaagtatctggatgagctgggcttcacggtatttgccggagttttgaatgaaaatggcccaggagctgaggaattgcgaagaacctgctctccgcgcctctcggtgctccaaatggacatcacgaagccagtgcagataaaagatgcttacagcaaggttgcagcaatgctgcaggacagaggactgtgggctgtgatcaacaatgctggggtgcttggctttccaactgatggggagcttcttcttatgactgactacaaacaatgcatggccgtgaacttctttggaactgtggaggtcacaaagacgtttttgcctcttcttagaaaatccaaagggaggctggtgaatgtcagcagcatgggaggaggggccccaatggaaaggctggcatcttatggctcatcaaaggcggctgtgaccatgttctcatcagttatgagactggagctttccaagtggggaattaaagttgcttccatccaacctggaggcttcctaacaaatatcgcaggcaccagtgacaagtgggaaaagctggagaaggacattctggaccacctccccgctgaggtacaggaagactacggccaggactacatcttagcacagcggaatttcctcctattgatcaactcgttagccagcaaggacttctctccggtgctgcgggacatccagcatgctatcttggcgaagagcccttttgcctattacacgccagggaaaggcgcttacttgtggatctgccttgctcactatttgcctattggcatatatgattactttgctaaaagacattttggccaagacaagcccatgcccagagctctaagaatgcctaactacaagaaaaaggccacctag
Sequence Length
1164
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,785 Da
NCBI Official Full Name
Homo sapiens hydroxysteroid (17-beta) dehydrogenase 2, mRNA
NCBI Official Synonym Full Names
hydroxysteroid 17-beta dehydrogenase 2
NCBI Official Symbol
HSD17B2
NCBI Official Synonym Symbols
HSD17; SDR9C2; EDH17B2
NCBI Protein Information
estradiol 17-beta-dehydrogenase 2
UniProt Protein Name
Estradiol 17-beta-dehydrogenase 2
UniProt Gene Name
HSD17B2
UniProt Synonym Gene Names
EDH17B2; SDR9C2; 17-beta-HSD 2; 20-alpha-HSD
UniProt Entry Name
DHB2_HUMAN

Uniprot Description

HSD17B2: Capable of catalyzing the interconversion of testosterone and androstenedione, as well as estradiol and estrone. Also has 20-alpha-HSD activity. Uses NADH while EDH17B3 uses NADPH. Belongs to the short-chain dehydrogenases/reductases (SDR) family.

Protein type: EC 1.1.1.239; Membrane protein, integral; EC 1.1.1.62; Lipid Metabolism - androgen and estrogen; Oxidoreductase; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 16q24.1-q24.2

Cellular Component: endoplasmic reticulum membrane

Molecular Function: 20-alpha-hydroxysteroid dehydrogenase activity; 3-alpha(17-beta)-hydroxysteroid dehydrogenase (NAD+) activity; estradiol 17-beta-dehydrogenase activity

Biological Process: response to retinoic acid

Research Articles on HSD17B2

Similar Products

Product Notes

The HSD17B2 hsd17b2 (Catalog #AAA1268738) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcactt tcttctcgga cacagcatgg atctgcctgg ctgtccccac agtactatgt gggacagtat tttgcaaata caagaagagc tcagggcagc tgtggagctg gatggtctgc ctggcaggcc tctgtgcagt ctgcctgctc atcctgtccc ctttttgggg cttgatcctc ttctcggtgt catgcttcct catgtatact tacttatctg gccaagaatt gttacctgtg gatcagaagg cagtcctggt gacaggtggt gattgcgggc ttggccatgc tttgtgcaag tatctggatg agctgggctt cacggtattt gccggagttt tgaatgaaaa tggcccagga gctgaggaat tgcgaagaac ctgctctccg cgcctctcgg tgctccaaat ggacatcacg aagccagtgc agataaaaga tgcttacagc aaggttgcag caatgctgca ggacagagga ctgtgggctg tgatcaacaa tgctggggtg cttggctttc caactgatgg ggagcttctt cttatgactg actacaaaca atgcatggcc gtgaacttct ttggaactgt ggaggtcaca aagacgtttt tgcctcttct tagaaaatcc aaagggaggc tggtgaatgt cagcagcatg ggaggagggg ccccaatgga aaggctggca tcttatggct catcaaaggc ggctgtgacc atgttctcat cagttatgag actggagctt tccaagtggg gaattaaagt tgcttccatc caacctggag gcttcctaac aaatatcgca ggcaccagtg acaagtggga aaagctggag aaggacattc tggaccacct ccccgctgag gtacaggaag actacggcca ggactacatc ttagcacagc ggaatttcct cctattgatc aactcgttag ccagcaagga cttctctccg gtgctgcggg acatccagca tgctatcttg gcgaagagcc cttttgccta ttacacgcca gggaaaggcg cttacttgtg gatctgcctt gctcactatt tgcctattgg catatatgat tactttgcta aaagacattt tggccaagac aagcccatgc ccagagctct aagaatgcct aactacaaga aaaaggccac ctag. It is sometimes possible for the material contained within the vial of "HSD17B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.