Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TGIF2 cdna clone

TGIF2 cDNA Clone

Synonyms
TGIF2; TGIF2 cDNA Clone; TGIF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggacagtgatctaggtgaggacgaaggcctcctctccctggcgggcaaaaggaagcgcagggggaacctgcccaaggagtcggtgaagatcctccgggactggctgtacttgcaccgctacaacgcctacccctcagagcaggagaagctgagcctttctggacagaccaacctgtcagtgctgcaaatatgtaactggttcatcaatgcccggcggcggcttctcccagacatgcttcggaaggatggcaaagaccctaatcagtttaccatttcccgccgcgggggtaaggcctcagatgtggccctcccccgtggcagcagcccctcagtgctggctgtgtctgtcccagcccccaccaatgtgctctccctgtctgtgtgctccatgccgcttcactcaggccagggggaaaagccagcagcccctttcccacgtggggagctggagtctcccaagcccctggtgacccctggtagcacacttactctgctgaccagggctgaggctggaagccccacaggtggactcttcaacacgccaccacccacacccccagagcaggacaaagaggacttcagcagcttccagctgctggtggaggtggcgctacagagggctgctgagatggagcttcagaagcagcaggacccatcactcccattactgcacactcccatccctttagtctctgaaaatccccagtag
Sequence Length
714
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,908 Da
NCBI Official Full Name
Homo sapiens TGFB-induced factor homeobox 2, mRNA
NCBI Official Synonym Full Names
TGFB induced factor homeobox 2
NCBI Official Symbol
TGIF2
NCBI Protein Information
homeobox protein TGIF2
UniProt Protein Name
Homeobox protein TGIF2
Protein Family
UniProt Gene Name
TGIF2
UniProt Synonym Gene Names
TGFB-induced factor 2
UniProt Entry Name
TGIF2_HUMAN

NCBI Description

The protein encoded by this gene is a DNA-binding homeobox protein and a transcriptional repressor, which appears to repress transcription by recruiting histone deacetylases to TGF beta-responsive genes. This gene is amplified and over-expressed in some ovarian cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. Read-through transcription also exists between this gene and the neighboring downstream C20orf24 (chromosome 20 open reading frame 24) gene. [provided by RefSeq, Dec 2010]

Uniprot Description

TGIF2: Transcriptional repressor, which probably repress transcription by binding directly the 5'-CTGTCAA-3' DNA sequence or by interacting with TGF-beta activated SMAD proteins. Probably represses transcription via the recruitment of histone deacetylase proteins. Belongs to the TALE/TGIF homeobox family.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 20q11.23

Cellular Component: nucleoplasm; nucleus

Biological Process: negative regulation of transcription from RNA polymerase II promoter

Research Articles on TGIF2

Similar Products

Product Notes

The TGIF2 tgif2 (Catalog #AAA1268592) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggaca gtgatctagg tgaggacgaa ggcctcctct ccctggcggg caaaaggaag cgcaggggga acctgcccaa ggagtcggtg aagatcctcc gggactggct gtacttgcac cgctacaacg cctacccctc agagcaggag aagctgagcc tttctggaca gaccaacctg tcagtgctgc aaatatgtaa ctggttcatc aatgcccggc ggcggcttct cccagacatg cttcggaagg atggcaaaga ccctaatcag tttaccattt cccgccgcgg gggtaaggcc tcagatgtgg ccctcccccg tggcagcagc ccctcagtgc tggctgtgtc tgtcccagcc cccaccaatg tgctctccct gtctgtgtgc tccatgccgc ttcactcagg ccagggggaa aagccagcag cccctttccc acgtggggag ctggagtctc ccaagcccct ggtgacccct ggtagcacac ttactctgct gaccagggct gaggctggaa gccccacagg tggactcttc aacacgccac cacccacacc cccagagcag gacaaagagg acttcagcag cttccagctg ctggtggagg tggcgctaca gagggctgct gagatggagc ttcagaagca gcaggaccca tcactcccat tactgcacac tcccatccct ttagtctctg aaaatcccca gtag. It is sometimes possible for the material contained within the vial of "TGIF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.