Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRRK1 cdna clone

LRRK1 cDNA Clone

Gene Names
LRRK1; RIPK6; Roco1
Synonyms
LRRK1; LRRK1 cDNA Clone; LRRK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgcaaagaccccccagcatgtactggtgtgtggggccggaggagtcagctgtgtgtccagaacgtgccatggagacgcttaacggtgccggggacacgggcggcaagccgtccacgcggggcggtgaccctgcagcgcggtcccgcaggacggaaggcatccgcgccgcgtacaggcggggagaccgcggcggcgcccgggacctgctggaggaggcctgcgaccagtgcgcgtcccagctggaaaagggccagcttctgagcatcccggcagcctatggggatctggagatggtccgctacctactcagcaagagactggtggagctgcccaccgagcccacggatgacaacccagccgtggtggcagcgtattttggacacacggcagttgtgcaggaattgcttgagtccttaccaggtccctgcagtccccagcggcttctgaactggatgctggccttggcttgccagcgagggcacctgggggttgtgaagctcctggtcctgacgcacggggctgacccggagagctacgctgtcaggaagaatgagttccctgtcatcgtgcgcttgcccctgtatgcggccatcaagtcagggaatgaagacattgcaatattcctgcttcggcatggggcctatttctgttcctacatcttgctggatagtcctgaccccagcaaacatctgctgagaaagtacttcattgaagccagtcccttgcccagcagttatccgggaaaaacagtgagtagtcactgcctgtggagtgtgttttag
Sequence Length
786
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,848 Da
NCBI Official Full Name
Homo sapiens leucine-rich repeat kinase 1, mRNA
NCBI Official Synonym Full Names
leucine rich repeat kinase 1
NCBI Official Symbol
LRRK1
NCBI Official Synonym Symbols
RIPK6; Roco1
NCBI Protein Information
leucine-rich repeat serine/threonine-protein kinase 1
UniProt Protein Name
Leucine-rich repeat serine/threonine-protein kinase 1
UniProt Gene Name
LRRK1
UniProt Entry Name
LRRK1_HUMAN

Uniprot Description

LRRK1: a large multidomain protein kinase with a TKL-type kinase domain, multiple protein-protein interaction domains and a mitochondrial Rho domain (MIRO). Involved in the trafficking of epidermal growth factor (EGFR) from early to late endosomes. Forms a complex with activated EGFR via the adaptor protein Grb2. Subsequently, LRRK1 and EGFR are internalized and co-localized in early endosomes. LRRK1 is phosphorylated by EGFR, inhibiting its kinase activity. The reduction of kinase activity plays an important role in endosomal trafficking of the EGFR. Serves as a scaffold expediting the interaction of EGFR with the endosomal sorting complex required for efficient sorting of EGFR to the inner vesicles of multivesicular bodies. Plays a critical role in negative regulation of bone mass in part through modulating the c-Src signaling pathway in mice. Phosphorylation of c-Src at Tyr-527 is significantly elevated whereas at Tyr-416 is decreased in LRRK1 KO mouse osteoclasts.

Protein type: Protein kinase, TKL; Kinase, protein; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); TKL group; LRRK family

Chromosomal Location of Human Ortholog: 15q26.3

Cellular Component: cytoplasm; mitochondrion

Molecular Function: identical protein binding; protein binding

Research Articles on LRRK1

Similar Products

Product Notes

The LRRK1 lrrk1 (Catalog #AAA1268581) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgcaaa gaccccccag catgtactgg tgtgtggggc cggaggagtc agctgtgtgt ccagaacgtg ccatggagac gcttaacggt gccggggaca cgggcggcaa gccgtccacg cggggcggtg accctgcagc gcggtcccgc aggacggaag gcatccgcgc cgcgtacagg cggggagacc gcggcggcgc ccgggacctg ctggaggagg cctgcgacca gtgcgcgtcc cagctggaaa agggccagct tctgagcatc ccggcagcct atggggatct ggagatggtc cgctacctac tcagcaagag actggtggag ctgcccaccg agcccacgga tgacaaccca gccgtggtgg cagcgtattt tggacacacg gcagttgtgc aggaattgct tgagtcctta ccaggtccct gcagtcccca gcggcttctg aactggatgc tggccttggc ttgccagcga gggcacctgg gggttgtgaa gctcctggtc ctgacgcacg gggctgaccc ggagagctac gctgtcagga agaatgagtt ccctgtcatc gtgcgcttgc ccctgtatgc ggccatcaag tcagggaatg aagacattgc aatattcctg cttcggcatg gggcctattt ctgttcctac atcttgctgg atagtcctga ccccagcaaa catctgctga gaaagtactt cattgaagcc agtcccttgc ccagcagtta tccgggaaaa acagtgagta gtcactgcct gtggagtgtg ttttag. It is sometimes possible for the material contained within the vial of "LRRK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.