Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABCC11 cdna clone

ABCC11 cDNA Clone

Gene Names
ABCC11; WW; EWWD; MRP8
Synonyms
ABCC11; ABCC11 cDNA Clone; ABCC11 cdna clone
Ordering
For Research Use Only!
Sequence
atgactaggaagaggacatactgggtgcccaactcttctggtggcctcgtgaatcgtggcatcgacataggcgatgacatggtttcaggacttatttataaaacctatactctccaagatggcccctggagtcagcaagagagaaatcctgaggctccagggagggcagctgtcccaccgtgggggaagtatgatgctgccttgagaaccatgattcccttccgtcccaagccgaggtttcctgccccccagcccctggacaatgctggcctgttctcctacctcaccgtgtcatggctcaccccgctcatgatccaaagcttacggagtcgcttagatgagaacaccatccctccactgtcagtccatgatgcctcagacaaaaatgtccaaaggcttcaccgcctttgggaagaagaagtctcaaggcgagggattgaaaaagcttcagtgcttctggtgatgctgaggttccagagaacaaggttgattttcgatgcacttctgggcatctgcttctgcattgccagtgtactcgggccaatattgattataccaaagatcctggaatattcagaagagcagttggggaatgttgtccatggagtgggactctgctttgccctttttctctccgaatgtgtgaagtctctgagtttctcctccagttggatcatcaaccaacgcacagccatcaggttccgagcagctgtttcctcctttgcctttgagaagctcatccaatttaagtctgtaatacacatcacctcaggagaggccatcagcttcttcaccggtgatgtaaactacctgtttgaaggggtgtgctatggacccctagtactgatcacctgcgcatcgctggtcatctgcagcatttcttcctacttcattattggatacactgcatttattgccatcttatgctatctcctggttttcccactggcggtattcatgacaagaatggctgtgaaggctcagcatcacacatctgaggtcagcgaccagcgcatccgtgtgaccagtgaagttctcacttgcattaagctgattaaaatgtacacatgggagaaaccatttgcaaaaatcattgaagacctaagaaggaaggaaaggaaactattggagaagtgcgggcttgtccagagcctgacaagtataaccttgttcatcatccccacagtggccacagcggtctgggttctcatccacacatccttaaagctgaaactcacagcgtcaatggccttcagcatgctggcctccttgaatctccttcggctgtcagtgttctttgtgcctattgcagtcaaaggtctcacgaattccaagtctgcagtgatgaggttcaagaagtttttcctccaggagagccctgttttctatgtccagacattacaagaccccagcaaagctctggtctttgaggaggccaccttgtcatggcaacagacctgtcccgggatcgtcaatggggcactggagctggagaggaacgggcatgcttctgaggggatgaccaggcctagagatgccctcgggccagaggaagaagggaacagcctgggcccagagttgcacaagatcaacctggtggtgtccaaggtagccttgttcaggccacgcaggcaggccagctgccaggctctcaggacctga
Sequence Length
1662
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
150,093 Da
NCBI Official Full Name
Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 11, mRNA
NCBI Official Synonym Full Names
ATP binding cassette subfamily C member 11
NCBI Official Symbol
ABCC11
NCBI Official Synonym Symbols
WW; EWWD; MRP8
NCBI Protein Information
ATP-binding cassette sub-family C member 11
UniProt Protein Name
ATP-binding cassette sub-family C member 11
Protein Family
UniProt Gene Name
ABCC11
UniProt Synonym Gene Names
MRP8
UniProt Entry Name
ABCCB_HUMAN

NCBI Description

The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ABCC11: Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides. Enhances the cellular extrusion of cAMP and cGMP. Stimulates the ATP-dependent uptake of a range of physiological and synthetic lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate (DHEAS) and estrone 3-sulfate, glucuronides such as estradiol 17-beta-D-glucuronide (E(2)17betaG), the monoanionic bile acids glycocholate and taurocholate, and methotrexate. Probably functions to secrete earwax. Belongs to the ABC transporter superfamily. ABCC family. Conjugate transporter (TC 3.A.1.208) subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transporter; Transporter, ABC family; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 16q12.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: anion transmembrane-transporting ATPase activity; organic anion transmembrane transporter activity; purine nucleotide transmembrane transporter activity

Biological Process: organic anion transport; purine nucleotide transport; transmembrane transport

Disease: Apocrine Gland Secretion, Variation In

Research Articles on ABCC11

Similar Products

Product Notes

The ABCC11 abcc11 (Catalog #AAA1268541) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactagga agaggacata ctgggtgccc aactcttctg gtggcctcgt gaatcgtggc atcgacatag gcgatgacat ggtttcagga cttatttata aaacctatac tctccaagat ggcccctgga gtcagcaaga gagaaatcct gaggctccag ggagggcagc tgtcccaccg tgggggaagt atgatgctgc cttgagaacc atgattccct tccgtcccaa gccgaggttt cctgcccccc agcccctgga caatgctggc ctgttctcct acctcaccgt gtcatggctc accccgctca tgatccaaag cttacggagt cgcttagatg agaacaccat ccctccactg tcagtccatg atgcctcaga caaaaatgtc caaaggcttc accgcctttg ggaagaagaa gtctcaaggc gagggattga aaaagcttca gtgcttctgg tgatgctgag gttccagaga acaaggttga ttttcgatgc acttctgggc atctgcttct gcattgccag tgtactcggg ccaatattga ttataccaaa gatcctggaa tattcagaag agcagttggg gaatgttgtc catggagtgg gactctgctt tgcccttttt ctctccgaat gtgtgaagtc tctgagtttc tcctccagtt ggatcatcaa ccaacgcaca gccatcaggt tccgagcagc tgtttcctcc tttgcctttg agaagctcat ccaatttaag tctgtaatac acatcacctc aggagaggcc atcagcttct tcaccggtga tgtaaactac ctgtttgaag gggtgtgcta tggaccccta gtactgatca cctgcgcatc gctggtcatc tgcagcattt cttcctactt cattattgga tacactgcat ttattgccat cttatgctat ctcctggttt tcccactggc ggtattcatg acaagaatgg ctgtgaaggc tcagcatcac acatctgagg tcagcgacca gcgcatccgt gtgaccagtg aagttctcac ttgcattaag ctgattaaaa tgtacacatg ggagaaacca tttgcaaaaa tcattgaaga cctaagaagg aaggaaagga aactattgga gaagtgcggg cttgtccaga gcctgacaag tataaccttg ttcatcatcc ccacagtggc cacagcggtc tgggttctca tccacacatc cttaaagctg aaactcacag cgtcaatggc cttcagcatg ctggcctcct tgaatctcct tcggctgtca gtgttctttg tgcctattgc agtcaaaggt ctcacgaatt ccaagtctgc agtgatgagg ttcaagaagt ttttcctcca ggagagccct gttttctatg tccagacatt acaagacccc agcaaagctc tggtctttga ggaggccacc ttgtcatggc aacagacctg tcccgggatc gtcaatgggg cactggagct ggagaggaac gggcatgctt ctgaggggat gaccaggcct agagatgccc tcgggccaga ggaagaaggg aacagcctgg gcccagagtt gcacaagatc aacctggtgg tgtccaaggt agccttgttc aggccacgca ggcaggccag ctgccaggct ctcaggacct ga. It is sometimes possible for the material contained within the vial of "ABCC11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.