Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TARDBP cdna clone

TARDBP cDNA Clone

Gene Names
TARDBP; ALS10; TDP-43
Synonyms
TARDBP; TARDBP cDNA Clone; TARDBP cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgaatatattcgggtaaccgaagatgagaacgatgagcccattgaaataccatcggaagacgatgggacggtgctgctctccacggttacagcccagtttccaggggcgtgtgggcttcgctacaggaatccagtgtctcagtgtatgagaggtgtccggctggtagaaggaattctgcatgccccagatgctggctggggaaatctggtgtatgttgtcaactatccaaaagataacaaaagaaaaatggatgagacagatgcttcatcagcagtgaaagtgaaaagagcagtccagaaaacatccgatttaatagtgttgggtctcccatggaaaacaaccgaacaggacctgaaagagtattttagtacctttggagaagttcttatggtgcaggtcaagaaagatcttaagactggtcattcaaaggggtttggctttgttcgttttacggaatatgaaacacaagtgaaagtaatgtcacagcgacatatgatagatggacgatggtgtgactgcaaacttcctaattctaagcaaagccaagatgagcctttgagaagcagaaaagtgtttgtggggcgctgtacagaggacatgactgaggatgagctgcgggagttcttctctcagtacggggatgtgatggatgtcttcatccccaagccattcagggcctttgcctttgttacatttgcagatgatcagattgcgcagtctctttgtggagaggacttgatcattaaaggaatcagcgttcatatatccaatgccgaacctaagcacaatagcaatagacagttagaaagaagtggaagatttggtggtaatccaggtggctttgggaatcagggtggatttggtaatagcagagggggtggagctggtttgggaaacaatcaaggtagtaatatgggtggtgggatgaactttggtgcgttcagcattaatccagccatgatggctgccgcccaggcagcactacagagcagttggggtatgatgggcatgttagccagccagcagaaccagtcaggcccatcgggtaataaccaaaaccaaggcaacatgcagagggagccaaaccaggccttcggttctggaaataactcttatagtggctctaattctggtgcagcaattggttggggatcagcatccaatgcagggtcgggcagtggttttaatggaggctttggctcaagcatggattctaagtcttctggctggggaatgtag
Sequence Length
1245
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,808 Da
NCBI Official Full Name
Homo sapiens TAR DNA binding protein, mRNA
NCBI Official Synonym Full Names
TAR DNA binding protein
NCBI Official Symbol
TARDBP
NCBI Official Synonym Symbols
ALS10; TDP-43
NCBI Protein Information
TAR DNA-binding protein 43
UniProt Protein Name
TAR DNA-binding protein 43
Protein Family
UniProt Gene Name
TARDBP
UniProt Synonym Gene Names
TDP43; TDP-43
UniProt Entry Name
TADBP_HUMAN

NCBI Description

HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008]

Uniprot Description

TARDBP: DNA and RNA-binding protein which regulates transcription and splicing. Involved in the regulation of CFTR splicing. It promotes CFTR exon 9 skipping by binding to the UG repeated motifs in the polymorphic region near the 3'-splice site of this exon. The resulting aberrant splicing is associated with pathological features typical of cystic fibrosis. May also be involved in microRNA biogenesis, apoptosis and cell division. Can repress HIV-1 transcription by binding to the HIV-1 long terminal repeat. Stabilizes the low molecular weight neurofilament (NFL) mRNA through a direct interaction with the 3' UTR. Homodimer. Binds specifically to pyrimidine-rich motifs of TAR DNA and to single stranded TG repeated sequences. Binds to RNA, specifically to UG repeated sequences with a minimun of six contiguous repeats. Interacts with ATNX2; the interaction is RNA-dependent. Ubiquitously expressed. In particular, expression is high in pancreas, placenta, lung, genital tract and spleen. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 1p36.22

Cellular Component: nucleoplasm; nucleus

Molecular Function: double-stranded DNA binding; identical protein binding; mRNA 3'-UTR binding; protein binding; RNA binding; transcription factor activity

Biological Process: negative regulation of protein amino acid phosphorylation; nuclear fragmentation during apoptosis; regulation of cell cycle; RNA splicing

Disease: Amyotrophic Lateral Sclerosis 10, With Or Without Frontotemporal Dementia

Research Articles on TARDBP

Similar Products

Product Notes

The TARDBP tardbp (Catalog #AAA1268491) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaat atattcgggt aaccgaagat gagaacgatg agcccattga aataccatcg gaagacgatg ggacggtgct gctctccacg gttacagccc agtttccagg ggcgtgtggg cttcgctaca ggaatccagt gtctcagtgt atgagaggtg tccggctggt agaaggaatt ctgcatgccc cagatgctgg ctggggaaat ctggtgtatg ttgtcaacta tccaaaagat aacaaaagaa aaatggatga gacagatgct tcatcagcag tgaaagtgaa aagagcagtc cagaaaacat ccgatttaat agtgttgggt ctcccatgga aaacaaccga acaggacctg aaagagtatt ttagtacctt tggagaagtt cttatggtgc aggtcaagaa agatcttaag actggtcatt caaaggggtt tggctttgtt cgttttacgg aatatgaaac acaagtgaaa gtaatgtcac agcgacatat gatagatgga cgatggtgtg actgcaaact tcctaattct aagcaaagcc aagatgagcc tttgagaagc agaaaagtgt ttgtggggcg ctgtacagag gacatgactg aggatgagct gcgggagttc ttctctcagt acggggatgt gatggatgtc ttcatcccca agccattcag ggcctttgcc tttgttacat ttgcagatga tcagattgcg cagtctcttt gtggagagga cttgatcatt aaaggaatca gcgttcatat atccaatgcc gaacctaagc acaatagcaa tagacagtta gaaagaagtg gaagatttgg tggtaatcca ggtggctttg ggaatcaggg tggatttggt aatagcagag ggggtggagc tggtttggga aacaatcaag gtagtaatat gggtggtggg atgaactttg gtgcgttcag cattaatcca gccatgatgg ctgccgccca ggcagcacta cagagcagtt ggggtatgat gggcatgtta gccagccagc agaaccagtc aggcccatcg ggtaataacc aaaaccaagg caacatgcag agggagccaa accaggcctt cggttctgga aataactctt atagtggctc taattctggt gcagcaattg gttggggatc agcatccaat gcagggtcgg gcagtggttt taatggaggc tttggctcaa gcatggattc taagtcttct ggctggggaa tgtag. It is sometimes possible for the material contained within the vial of "TARDBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.