MYO1D cdna clone
MYO1D cDNA Clone
Gene Names
MYO1D; myr4; PPP1R108
Synonyms
MYO1D; MYO1D cDNA Clone; MYO1D cdna clone
Sequence
atggcggagcaggagagcctggaattcggcaaggcagacttcgtgctgatggacaccgtctccatgcccgagttcatggccaacctcaggctcagatttgaaaaagggcgcatctatacgttcattggagaagtcgtcgtttctgtgaacccttacaagttgttgaacatctatggaagagacacaattgagcagtataaaggccgtgagctgtatgagagaccgcctcacctttttgctattgcggatgctgcttacaaggctatgaagaggcgatcaaaagacacttgtattgtgatatcaggggaaagtggagctggtaaaacggaagccagtaagtacattatgcagtatattgcggccatcaccaaccccagtcagagagcagaggttgaaagagtgaagaatatgttgcttaagtccaactgtgttttggaagcttttggaaatgccaaaaccaaccgtaatgacaactcaagcaggtttggaaaatacatggatatcaactttgacttcaagggtgaccctattggtgggcatatcaataactacttactagaaaagtctcgagtgattgtgcaacagccaggagaaagaagctttcattctttctatcagctactccaaggaggttcagaacaaatgctacgctctctacatctccagaaatccctttcatcctacaactatattcatgtgggagctcaattaaagtcttctatcaatgatgctgccgaattcagagttgttgctgatgccatgaaagtcattggcttcaaacctgaggagatccaaacagtgtataagattttggctgctattctgcacttgggaaatttaaaatttgtagtagatggtgacacgcctcttattgagaatggcaaagtagtatctatcatagcagaattgctctctactaagacagatatggttgagaaagcccttctttaccggactgtggccacaggccgtgacatcattgacaagcagcacacagaacaagaggccagctacggcagagacgcctttgccaaggcaatatatgagcgccttttttgttggatcgttactcgcatcaatgatattattgaggtcaagaactatgacaccacaatccatgggaaaaacactgttattggtgtcttggatatctatggctttgaaatctttgacaacaacagttttgaacaattctgtatcaattactgcaatgagaaactgcagcagctatttattcagctggttctgaagcaagaacaagaggaataccagcgggaagggatcccctggaaacatgtgggattgctataa
Sequence Length
1311
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
116,202 Da
NCBI Official Full Name
Homo sapiens myosin ID, mRNA
NCBI Official Synonym Full Names
myosin ID
NCBI Official Symbol
MYO1D
NCBI Official Synonym Symbols
myr4; PPP1R108
NCBI Protein Information
unconventional myosin-Id
UniProt Protein Name
Unconventional myosin-Id
Protein Family
UniProt Gene Name
MYO1D
UniProt Synonym Gene Names
KIAA0727
UniProt Entry Name
MYO1D_HUMAN
Uniprot Description
MYO1D: Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments.
Protein type: Motility/polarity/chemotaxis; Motor
Chromosomal Location of Human Ortholog: 17q11-q12
Cellular Component: axon; basolateral plasma membrane; brush border; cell soma; cytoplasmic vesicle; endosome; myelin sheath; neuron projection
Molecular Function: actin filament binding; actin-dependent ATPase activity; calmodulin binding; protein domain specific binding
Biological Process: cellular localization
Research Articles on MYO1D
Similar Products
Product Notes
The MYO1D myo1d (Catalog #AAA1268485) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagc aggagagcct ggaattcggc aaggcagact tcgtgctgat ggacaccgtc tccatgcccg agttcatggc caacctcagg ctcagatttg aaaaagggcg catctatacg ttcattggag aagtcgtcgt ttctgtgaac ccttacaagt tgttgaacat ctatggaaga gacacaattg agcagtataa aggccgtgag ctgtatgaga gaccgcctca cctttttgct attgcggatg ctgcttacaa ggctatgaag aggcgatcaa aagacacttg tattgtgata tcaggggaaa gtggagctgg taaaacggaa gccagtaagt acattatgca gtatattgcg gccatcacca accccagtca gagagcagag gttgaaagag tgaagaatat gttgcttaag tccaactgtg ttttggaagc ttttggaaat gccaaaacca accgtaatga caactcaagc aggtttggaa aatacatgga tatcaacttt gacttcaagg gtgaccctat tggtgggcat atcaataact acttactaga aaagtctcga gtgattgtgc aacagccagg agaaagaagc tttcattctt tctatcagct actccaagga ggttcagaac aaatgctacg ctctctacat ctccagaaat ccctttcatc ctacaactat attcatgtgg gagctcaatt aaagtcttct atcaatgatg ctgccgaatt cagagttgtt gctgatgcca tgaaagtcat tggcttcaaa cctgaggaga tccaaacagt gtataagatt ttggctgcta ttctgcactt gggaaattta aaatttgtag tagatggtga cacgcctctt attgagaatg gcaaagtagt atctatcata gcagaattgc tctctactaa gacagatatg gttgagaaag cccttcttta ccggactgtg gccacaggcc gtgacatcat tgacaagcag cacacagaac aagaggccag ctacggcaga gacgcctttg ccaaggcaat atatgagcgc cttttttgtt ggatcgttac tcgcatcaat gatattattg aggtcaagaa ctatgacacc acaatccatg ggaaaaacac tgttattggt gtcttggata tctatggctt tgaaatcttt gacaacaaca gttttgaaca attctgtatc aattactgca atgagaaact gcagcagcta tttattcagc tggttctgaa gcaagaacaa gaggaatacc agcgggaagg gatcccctgg aaacatgtgg gattgctata a. It is sometimes possible for the material contained within the vial of "MYO1D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
