SLC25A23 cdna clone
SLC25A23 cDNA Clone
Gene Names
SLC25A23; APC2; MCSC2; SCaMC-3
Synonyms
SLC25A23; SLC25A23 cDNA Clone; SLC25A23 cdna clone
Sequence
atgcgggggagcccgggcgacgcggagcggcggcagcgctggggtcgcctgttcgaggagctggacagtaacaaggatggccgcgtggacgtgcacgagttgcgccaggggctggccaggctgggcgggggcaacccagaccccggcgcccaacagggtatctcctctgagggtgatgctgacccagatggcgggctcgacctggaggaattttcccgctatctgcaggagcgggaacagcgtctgctgctcatgtttcacagtcttgaccggaaccaggatggtcacattgatgtctctgagatccaacagagtttccgagctctgggcatttccatctcgctggagcaggctgagaaaattttgcacagcatggaccgagacggcacaatgaccattgactggcaagaatggcgcgaccacttcctgttgcattcgctggaaaatgtggaggacgtgctgtatttctggaagcattccacgctctcttctgctgggttctctgcctggataaaagattctacggctgaacagaatcgttcaaaaaccacggtcttggccaggcgcagtggctcacacctgaaatcccagcactttgggaggccgaagtgggcggatcacgaggtcctggacattggcgagtgcctgacagtgccggacgagttctcaaagcaagagaagctgacgggcatgtggtggaaacagctggtggccggcgcagtggcaggtgccgtgtcacggacaggcacggcccctctggaccgcctcaaggtcttcatgcaggtccatgcctcaaagaccaaccggctgaacatccttggggggcttcgaagcatggtccttgagggaggcatccgctccctgtggcgcggcaatggtattaatgtactcaagattgcccccgagtcagctatcaagttcatggcctatgaacagatcaagagggccatcctggggcagcaggagacactgcatgtgcaggagcgcttcgtggctggctccctggctggtgccacagcccaaaccatcatttaccctatggaggtgctgaagacgcggctgaccttgcgccggacgggccagtataaggggctgctggactgcgccaggcgtatcctggagagggaggggccccgtgccttctaccgcggctacctccccaacgtgctgggcatcatcccctatgcgggcatcgacctggccgtctacgagactctgaagaactggtggcttcagcagtacagccacgactcggcagacccaggcatcctcgtgctcctggcctgcggtaccatatccagcacctgcggccagatagccagttacccgctggccctggtccggacccgcatgcaggcacaaggctggagtacagtggctcgatttcagatcactgcaacctctgccttccaggttcaagcgattctcctgcctcagcctccagagtag
Sequence Length
1449
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,786 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 23
NCBI Official Symbol
SLC25A23
NCBI Official Synonym Symbols
APC2; MCSC2; SCaMC-3
NCBI Protein Information
calcium-binding mitochondrial carrier protein SCaMC-3
UniProt Protein Name
Calcium-binding mitochondrial carrier protein SCaMC-3
Protein Family
UniProt Gene Name
SLC25A23
UniProt Synonym Gene Names
APC2; MCSC2; SCAMC3
UniProt Entry Name
SCMC3_HUMAN
Uniprot Description
SLC25A23: Calcium-dependent mitochondrial solute carrier. Mitochondrial solute carriers shuttle metabolites, nucleotides, and cofactors through the mitochondrial inner membrane. May act as a ATP-Mg/Pi exchanger that mediates the transport of Mg-ATP in exchange for phosphate, catalyzing the net uptake or efflux of adenine nucleotides into or from the mitochondria. Belongs to the mitochondrial carrier family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Transporter, SLC family; Mitochondrial; Membrane protein, integral; Transporter
Chromosomal Location of Human Ortholog: 19p13.3
Molecular Function: protein binding; structural constituent of ribosome
Biological Process: mitochondrial calcium ion transport; translation
Research Articles on SLC25A23
Similar Products
Product Notes
The SLC25A23 slc25a23 (Catalog #AAA1268448) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggggga gcccgggcga cgcggagcgg cggcagcgct ggggtcgcct gttcgaggag ctggacagta acaaggatgg ccgcgtggac gtgcacgagt tgcgccaggg gctggccagg ctgggcgggg gcaacccaga ccccggcgcc caacagggta tctcctctga gggtgatgct gacccagatg gcgggctcga cctggaggaa ttttcccgct atctgcagga gcgggaacag cgtctgctgc tcatgtttca cagtcttgac cggaaccagg atggtcacat tgatgtctct gagatccaac agagtttccg agctctgggc atttccatct cgctggagca ggctgagaaa attttgcaca gcatggaccg agacggcaca atgaccattg actggcaaga atggcgcgac cacttcctgt tgcattcgct ggaaaatgtg gaggacgtgc tgtatttctg gaagcattcc acgctctctt ctgctgggtt ctctgcctgg ataaaagatt ctacggctga acagaatcgt tcaaaaacca cggtcttggc caggcgcagt ggctcacacc tgaaatccca gcactttggg aggccgaagt gggcggatca cgaggtcctg gacattggcg agtgcctgac agtgccggac gagttctcaa agcaagagaa gctgacgggc atgtggtgga aacagctggt ggccggcgca gtggcaggtg ccgtgtcacg gacaggcacg gcccctctgg accgcctcaa ggtcttcatg caggtccatg cctcaaagac caaccggctg aacatccttg gggggcttcg aagcatggtc cttgagggag gcatccgctc cctgtggcgc ggcaatggta ttaatgtact caagattgcc cccgagtcag ctatcaagtt catggcctat gaacagatca agagggccat cctggggcag caggagacac tgcatgtgca ggagcgcttc gtggctggct ccctggctgg tgccacagcc caaaccatca tttaccctat ggaggtgctg aagacgcggc tgaccttgcg ccggacgggc cagtataagg ggctgctgga ctgcgccagg cgtatcctgg agagggaggg gccccgtgcc ttctaccgcg gctacctccc caacgtgctg ggcatcatcc cctatgcggg catcgacctg gccgtctacg agactctgaa gaactggtgg cttcagcagt acagccacga ctcggcagac ccaggcatcc tcgtgctcct ggcctgcggt accatatcca gcacctgcgg ccagatagcc agttacccgc tggccctggt ccggacccgc atgcaggcac aaggctggag tacagtggct cgatttcaga tcactgcaac ctctgccttc caggttcaag cgattctcct gcctcagcct ccagagtag. It is sometimes possible for the material contained within the vial of "SLC25A23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
