Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EXOSC1 cdna clone

EXOSC1 cDNA Clone

Gene Names
EXOSC1; p13; CSL4; SKI4; Csl4p; Ski4p; CGI-108
Synonyms
EXOSC1; EXOSC1 cDNA Clone; EXOSC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccacctgtgagatactgcatccccggcgaacgtctgtgtaacttggaggagggcagcccgggcagcggcacctacacccgccacggctacatcttttcgtcgcttgccggctgtctgatgaagagcagcgagaatggcgcgcttccagtggtgtctgtagtgagagaaacagagtcccagttactgccagatgtgggagctattgtaacctgtaaggtctctagcatcaattcacgctttgccaaagtacacatcctgtatgtggggtccatgcctcttaagaactcttttcgaggaactatccgcaaggaagatgtccgagcaactgaaaaagacaaggttgaaatttataagagtttccgcccaggtgacattgtcttggccaaagtgatctccttaggtgatgcacagtccaactacctgctaaccaccgccgagaacgagctgggagtggtggtagcccacagtgagtcaggtatccagatggttcccatcagctggtgtgagatgcagtgccctaagacccacactaaagaattccggaaagtagcccgagtacaacccgaattcttgcagacctaa
Sequence Length
588
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,452 Da
NCBI Official Full Name
Homo sapiens exosome component 1, mRNA
NCBI Official Synonym Full Names
exosome component 1
NCBI Official Symbol
EXOSC1
NCBI Official Synonym Symbols
p13; CSL4; SKI4; Csl4p; Ski4p; CGI-108
NCBI Protein Information
exosome complex component CSL4
UniProt Protein Name
Exosome complex component CSL4
UniProt Gene Name
EXOSC1
UniProt Synonym Gene Names
CSL4
UniProt Entry Name
EXOS1_HUMAN

NCBI Description

This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

EXOSC1: Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC1 as peripheral part of the Exo-9 complex stabilizes the hexameric ring of RNase PH-domain subunits through contacts with EXOSC6 and EXOSC8.

Protein type: EC 3.1.13.-; Ribonuclease; RNA-binding; Nucleolus

Chromosomal Location of Human Ortholog: 10q24

Cellular Component: cytoplasm; cytosol; exosome (RNase complex); nuclear exosome (RNase complex); nucleolus; nucleoplasm; nucleus

Molecular Function: exoribonuclease activity; protein binding

Biological Process: regulation of mRNA stability; rRNA processing

Research Articles on EXOSC1

Similar Products

Product Notes

The EXOSC1 exosc1 (Catalog #AAA1268440) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccac ctgtgagata ctgcatcccc ggcgaacgtc tgtgtaactt ggaggagggc agcccgggca gcggcaccta cacccgccac ggctacatct tttcgtcgct tgccggctgt ctgatgaaga gcagcgagaa tggcgcgctt ccagtggtgt ctgtagtgag agaaacagag tcccagttac tgccagatgt gggagctatt gtaacctgta aggtctctag catcaattca cgctttgcca aagtacacat cctgtatgtg gggtccatgc ctcttaagaa ctcttttcga ggaactatcc gcaaggaaga tgtccgagca actgaaaaag acaaggttga aatttataag agtttccgcc caggtgacat tgtcttggcc aaagtgatct ccttaggtga tgcacagtcc aactacctgc taaccaccgc cgagaacgag ctgggagtgg tggtagccca cagtgagtca ggtatccaga tggttcccat cagctggtgt gagatgcagt gccctaagac ccacactaaa gaattccgga aagtagcccg agtacaaccc gaattcttgc agacctaa. It is sometimes possible for the material contained within the vial of "EXOSC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.