AFMID cdna clone
AFMID cDNA Clone
Gene Names
AFMID; KF; FKF; KFA
Synonyms
AFMID; AFMID cDNA Clone; AFMID cdna clone
Sequence
atgatggatgtgtctggtgtgggtttcccaagcaaggttccttggaagaagatgtctgcagaggagctggagaatcagtactgtcccagccgatgggttgtccgactgggagcagaggaagccttgaggacctactcacagataggaattgaagccaccacaagggcccgggccaccaggaagagcctgctgcatgtcccctatggagacggcgaaggggagaaagtggacatttacttccccgacgagtcgtctgaagccttgcctttcttcctgttctttcacggaggatactggcagagcggaagtaaggatgagtctgccttcatggtccacccgctgacggcacagggagtggccgtggtaatagtggcttacggcatcgcccccaaaggcaccctggaccacatggtagaccaggtgacccgcagcgttgcgtttgtccagaagcggtatccaagcaacaagggaatttacctgtgtggacactcagccggggcccacctggctgccatgatgctcctggccgactggaccaagcatggggtcacgcccaacctcagaggctttttcctggtgagtggggtctttgacctggagcccatcgtgtatacttcacagaacgttgctctccagctgaccctggaggacgctcagaggaatagcccccagctgaaggtggcccaggcacagccggtggaccccacctgccgtgtgctggtggtcgtgggccagttcgactcccccgaattccaccgacagtcctgggagttttaccagaccctgtgtcaaggagagtggaaagcctcatttgaagagctccacgatgtggaccactttgaaattgttgagaatctgacccagaaggacaacgtgctcacccagattatcttgaaaacaatcttccagtag
Sequence Length
912
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,528 Da
NCBI Official Full Name
Homo sapiens arylformamidase, mRNA
NCBI Official Synonym Full Names
arylformamidase
NCBI Official Symbol
AFMID
NCBI Official Synonym Symbols
KF; FKF; KFA
NCBI Protein Information
kynurenine formamidase
UniProt Protein Name
Kynurenine formamidase
UniProt Gene Name
AFMID
UniProt Synonym Gene Names
KFA; KFase; FKF
UniProt Entry Name
KFA_HUMAN
Uniprot Description
AFMID: Catalyzes the hydrolysis of N-formyl-L-kynurenine to L- kynurenine, the second step in the kynurenine pathway of tryptophan degradation. Kynurenine may be further oxidized to nicotinic acid, NAD(H) and NADP(H). Required for elimination of toxic metabolites. Belongs to the kynurenine formamidase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Amino Acid Metabolism - tryptophan; Hydrolase; Carbohydrate Metabolism - glyoxylate and dicarboxylate; EC 3.5.1.9
Chromosomal Location of Human Ortholog: 17q25.3
Cellular Component: cytoplasm
Molecular Function: hydrolase activity
Biological Process: tryptophan catabolic process to kynurenine
Research Articles on AFMID
1. Observational study of gene-disease association and gene-environment interaction. (HuGE Navigator)
Similar Products
Product Notes
The AFMID afmid (Catalog #AAA1268376) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggatg tgtctggtgt gggtttccca agcaaggttc cttggaagaa gatgtctgca gaggagctgg agaatcagta ctgtcccagc cgatgggttg tccgactggg agcagaggaa gccttgagga cctactcaca gataggaatt gaagccacca caagggcccg ggccaccagg aagagcctgc tgcatgtccc ctatggagac ggcgaagggg agaaagtgga catttacttc cccgacgagt cgtctgaagc cttgcctttc ttcctgttct ttcacggagg atactggcag agcggaagta aggatgagtc tgccttcatg gtccacccgc tgacggcaca gggagtggcc gtggtaatag tggcttacgg catcgccccc aaaggcaccc tggaccacat ggtagaccag gtgacccgca gcgttgcgtt tgtccagaag cggtatccaa gcaacaaggg aatttacctg tgtggacact cagccggggc ccacctggct gccatgatgc tcctggccga ctggaccaag catggggtca cgcccaacct cagaggcttt ttcctggtga gtggggtctt tgacctggag cccatcgtgt atacttcaca gaacgttgct ctccagctga ccctggagga cgctcagagg aatagccccc agctgaaggt ggcccaggca cagccggtgg accccacctg ccgtgtgctg gtggtcgtgg gccagttcga ctcccccgaa ttccaccgac agtcctggga gttttaccag accctgtgtc aaggagagtg gaaagcctca tttgaagagc tccacgatgt ggaccacttt gaaattgttg agaatctgac ccagaaggac aacgtgctca cccagattat cttgaaaaca atcttccagt ag. It is sometimes possible for the material contained within the vial of "AFMID, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
