Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TLR2 cdna clone

TLR2 cDNA Clone

Gene Names
TLR2; TIL4; CD282
Synonyms
TLR2; TLR2 cDNA Clone; TLR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccacatactttgtggatggtgtgggtcttgggggtcatcatcagcctctccaaggaagaatcctccaatcaggcttctctgtcttgtgaccgcaatggtatctgcaagggcagctcaggatctttaaactccattccctcagggctcacagaagctgtaaaaagccttgacctgtccaacaacaggatcacctacattagcaacagtgacctacagaggtgtgtgaacctccaggctctggtgctgacatccaatggaattaacacaatagaggaagattctttttcttccctgggcagtcttgaacatttagacttatcctataattacttatctaatttatcgtcttcctggttcaagcccctttcttctttaacattcttaaacttactgggaaatccttacaaaaccctaggggaaacatctcttttttctcatctcacaaaattgcaaatcctgagagtgggaaatatggacaccttcactaagattcaaagaaaagattttgctggacttaccttccttgaggaacttgagattgatgcttcagatctacagagctatgagccaaaaagtttgaagtcaattcagaacgtaagtcatctgatccttcatatgaagcagcatattttactgctggagatttttgtagatgttacaagttccgtggaatgtttggaactgcgagatactgatttggacactttccatttttcagaactatccactggtgaaacaaattcattgattaaaaagtttacatttagaaatgtgaaaatcaccgatgaaagtttgtttcaggttatgaaacttttgaatcagatttctggattgttagaattagagtttgatgactgtacccttaatggagttggtaattttagagcatctgataatgacagagttatagatccaggtaaagtggaaacgttaacaatccggaggctgcatattccaaggttttacttattttatgatctgagcactttatattcacttacagaaagagttaaaagaatcacagtagaaaacagtaaagtttttctggttccttgtttactttcacaacatttaaaatcattagaatacttggatctcagtgaaaatttgatggttgaagaatacttgaaaaattcagcctgtgaggatgcctggccctctctacaaactttaattttaaggcaaaatcatttggcatcattggaaaaaaccggagagactttgctcactctgaaaaacttgactaacattgatatcagtaagaatagttttcattctatgcctgaaacttgtcagtggccagaaaagatgaaatatttgaacttatccagcacacgaatacacagtgtaacaggctgcattcccaagacactggaaattttagatgttagcaacaacaatctcaatttattttctttgaatttgccgcaactcaaagaactttatatttccagaaataagttgatgactctaccagatgcctccctcttacccatgttactagtattgaaaatcagtaggaatgcaataactacgttttctaaggagcaacttgactcatttcacacactgaagactttggaagctggtggcaataacttcatttgctcctgtgaattcctctccttcactcaggagcagcaagcactggccaaagtcttgattgattggccagcaaattacctgtgtgactctccatcccatgtgcgtggccagcaggttcaggatgtccgcctctcggtgtcggaatgtcacaggacagcactggtgtctggcatgtgctgtgctctgttcctgctgatcctgctcacgggggtcctgtgccaccgtttccatggcctgtggtatatgaaaatgatgtgggcctggctccaggccaaaaggaagcccaggaaagctcccagcaggaacatctgctatgatgcatttgtttcttacagtgagcgggatgcctactgggtggagaaccttatggtccaggagctggagaacttcaatccccccttcaagttgtgtcttcataagcgggacttcattcctggcaagtggatcattgacaatatcattgactccattgaaaagagccacaaaactgtctttgtgctttctgaaaactttgtgaagagtgagtggtgcaagtatgaactggacttctcccatttccgtctttttgatgagaacaatgatgctgccattctcattcttctggagcccattgagaaaaaagccattccccagcgcttctgcaagctgcggaagataatgaacaccaagacctacctggagtggcccatggacgaggctcagcgggaaggattttgggtaaatctgagagctgcgataaagtcctag
Sequence Length
2355
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
89,838 Da
NCBI Official Full Name
Homo sapiens toll-like receptor 2, mRNA
NCBI Official Synonym Full Names
toll like receptor 2
NCBI Official Symbol
TLR2
NCBI Official Synonym Symbols
TIL4; CD282
NCBI Protein Information
toll-like receptor 2
UniProt Protein Name
Toll-like receptor 2
Protein Family
UniProt Gene Name
TLR2
UniProt Synonym Gene Names
TIL4
UniProt Entry Name
TLR2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

TLR2: Cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. Cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. May also promote apoptosis in response to lipoproteins. Recognizes mycoplasmal macrophage- activating lipopeptide-2kD (MALP-2), soluble tuberculosis factor (STF), phenol-soluble modulin (PSM) and B.burgdorferi outer surface protein A lipoprotein (OspA-L) cooperatively with TLR6. Interacts with LY96, TLR1 and TLR6 (via extracellular domain). Binds MYD88 (via TIR domain). Interacts with TICAM1. Ligand binding induces the formation of a heterodimer with TLR1. Interacts with CNPY3. Highly expressed in peripheral blood leukocytes, in particular in monocytes, in bone marrow, lymph node and in spleen. Also detected in lung and in fetal liver. Levels are low in other tissues. Belongs to the Toll-like receptor family.

Protein type: Apoptosis; Cell surface; Membrane protein, integral; Motility/polarity/chemotaxis; Receptor, misc.

Chromosomal Location of Human Ortholog: 4q32

Cellular Component: cell surface; cytoplasm; Golgi apparatus; integral to plasma membrane; intrinsic to plasma membrane; lipid raft; plasma membrane

Molecular Function: lipopolysaccharide binding; lipopolysaccharide receptor activity; pattern recognition receptor activity; peptidoglycan binding; protein binding; protein heterodimerization activity; receptor activity; triacylated lipoprotein binding

Biological Process: activation of NF-kappaB transcription factor; apoptosis; cytokine secretion during immune response; defense response to Gram-positive bacterium; detection of diacylated bacterial lipoprotein; detection of triacylated bacterial lipoprotein; I-kappaB phosphorylation; immune response; innate immune response; interleukin-10 production; MyD88-dependent toll-like receptor signaling pathway; positive regulation of chemokine production; positive regulation of inflammatory response; positive regulation of interferon-beta production; positive regulation of interleukin-12 production; positive regulation of interleukin-18 production; positive regulation of interleukin-6 production; positive regulation of interleukin-8 production; positive regulation of NF-kappaB import into nucleus; positive regulation of nitric-oxide synthase biosynthetic process; positive regulation of toll-like receptor signaling pathway; positive regulation of transcription from RNA polymerase II promoter; positive regulation of tumor necrosis factor production; positive regulation of Wnt receptor signaling pathway; signal transduction

Disease: Leprosy, Susceptibility To, 3; Mycobacterium Tuberculosis, Susceptibility To

Research Articles on TLR2

Similar Products

Product Notes

The TLR2 tlr2 (Catalog #AAA1268345) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccacata ctttgtggat ggtgtgggtc ttgggggtca tcatcagcct ctccaaggaa gaatcctcca atcaggcttc tctgtcttgt gaccgcaatg gtatctgcaa gggcagctca ggatctttaa actccattcc ctcagggctc acagaagctg taaaaagcct tgacctgtcc aacaacagga tcacctacat tagcaacagt gacctacaga ggtgtgtgaa cctccaggct ctggtgctga catccaatgg aattaacaca atagaggaag attctttttc ttccctgggc agtcttgaac atttagactt atcctataat tacttatcta atttatcgtc ttcctggttc aagccccttt cttctttaac attcttaaac ttactgggaa atccttacaa aaccctaggg gaaacatctc ttttttctca tctcacaaaa ttgcaaatcc tgagagtggg aaatatggac accttcacta agattcaaag aaaagatttt gctggactta ccttccttga ggaacttgag attgatgctt cagatctaca gagctatgag ccaaaaagtt tgaagtcaat tcagaacgta agtcatctga tccttcatat gaagcagcat attttactgc tggagatttt tgtagatgtt acaagttccg tggaatgttt ggaactgcga gatactgatt tggacacttt ccatttttca gaactatcca ctggtgaaac aaattcattg attaaaaagt ttacatttag aaatgtgaaa atcaccgatg aaagtttgtt tcaggttatg aaacttttga atcagatttc tggattgtta gaattagagt ttgatgactg tacccttaat ggagttggta attttagagc atctgataat gacagagtta tagatccagg taaagtggaa acgttaacaa tccggaggct gcatattcca aggttttact tattttatga tctgagcact ttatattcac ttacagaaag agttaaaaga atcacagtag aaaacagtaa agtttttctg gttccttgtt tactttcaca acatttaaaa tcattagaat acttggatct cagtgaaaat ttgatggttg aagaatactt gaaaaattca gcctgtgagg atgcctggcc ctctctacaa actttaattt taaggcaaaa tcatttggca tcattggaaa aaaccggaga gactttgctc actctgaaaa acttgactaa cattgatatc agtaagaata gttttcattc tatgcctgaa acttgtcagt ggccagaaaa gatgaaatat ttgaacttat ccagcacacg aatacacagt gtaacaggct gcattcccaa gacactggaa attttagatg ttagcaacaa caatctcaat ttattttctt tgaatttgcc gcaactcaaa gaactttata tttccagaaa taagttgatg actctaccag atgcctccct cttacccatg ttactagtat tgaaaatcag taggaatgca ataactacgt tttctaagga gcaacttgac tcatttcaca cactgaagac tttggaagct ggtggcaata acttcatttg ctcctgtgaa ttcctctcct tcactcagga gcagcaagca ctggccaaag tcttgattga ttggccagca aattacctgt gtgactctcc atcccatgtg cgtggccagc aggttcagga tgtccgcctc tcggtgtcgg aatgtcacag gacagcactg gtgtctggca tgtgctgtgc tctgttcctg ctgatcctgc tcacgggggt cctgtgccac cgtttccatg gcctgtggta tatgaaaatg atgtgggcct ggctccaggc caaaaggaag cccaggaaag ctcccagcag gaacatctgc tatgatgcat ttgtttctta cagtgagcgg gatgcctact gggtggagaa ccttatggtc caggagctgg agaacttcaa tccccccttc aagttgtgtc ttcataagcg ggacttcatt cctggcaagt ggatcattga caatatcatt gactccattg aaaagagcca caaaactgtc tttgtgcttt ctgaaaactt tgtgaagagt gagtggtgca agtatgaact ggacttctcc catttccgtc tttttgatga gaacaatgat gctgccattc tcattcttct ggagcccatt gagaaaaaag ccattcccca gcgcttctgc aagctgcgga agataatgaa caccaagacc tacctggagt ggcccatgga cgaggctcag cgggaaggat tttgggtaaa tctgagagct gcgataaagt cctag. It is sometimes possible for the material contained within the vial of "TLR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.