TCF12 cdna clone
TCF12 cDNA Clone
Gene Names
TCF12; HEB; CRS3; HTF4; TCF-12; bHLHb20; HsT17266
Synonyms
TCF12; TCF12 cDNA Clone; TCF12 cdna clone
Sequence
atgaatccccagcaacaacgcatggccgctatagggaccgacaaggagctgagcgacctactggacttcagtgcgatgttttccccacctgttaatagtgggaaaactagaccaactacactgggaagcagtcagttcagtggatcaggtattgatgaaagaggaggtacaacatcttggggaacaagtggtcaaccaagtccttcctatgattcatctagaggttttacagacagccctcattacagtgatcacttgaatgacagtcgattaggagcccatgaaggcttgtccccaacacctttcatgaactcaaatctgatgggaaaaacatcagagagaggctcattttccctgtacagcagagatactggattaccaggctgtcaatctagtctcctgagacaagatctggggcttgggagcccagcacagctatcttcttcaggaaaacctgggacagcatactattcattctctgctacaagttccaggaggagaccactccatgactctgcagcgcttgatcccttgcaagcaaaaaaagtcagaaaggtgcctcctggtttgccttcttctgtatatgcaccatccccaaattcagatgatttcaaccgtgaatctcctagttatccatctcctaagccaccaaccagtatgttcgctagcactttctttatgcaagatgggacccacaattcttctgacctttggagttcatcaaatgggatgagccagcctggttttggtggaattctggggacctccacttcccacatgtctcaatccagtagttatggcaaccttcattcacatgaccgcttgagttatcctccacactcagtttcaccaacagacataaacacgagtcttccaccaatgtccagctttcatcgcggcagtaccagcagttcaccttacgttgctgcctcacacactcctcccatcaatggatcagacagcattctaggaaccagagggaatgctgctggaagctcacagacaggtgatgcacttggaaaggctttggcatctatttattctcctgaccataccagcagtagttttccgtcaaatccatcaacaccagttggatcaccttcacctctcacaggtaccagtcagtggccaagacctggagggcaagcaccttcatccccaagctatgaaaactcactccactccctgaaaaatcgagttgagcagcaacttcacgagcatttgcaagatgcaatgtccttcttaaaggatgtctgtgagcagtctcgaatggaggatcgtttagacagactggatgatgcaatccatgtgctgcggaaccatgctgtgggaccttccaccagtttgcctgctggtcacagtgatatacatagtttattgggaccatcccataatgcaccaattggaagcctcaattcaaactatggaggatcaagccttgttgcaagcagtcgatcagcttcaatggttggaactcatcgggaagactctgtcagtctcaatggcaatcattcagtcctgtctagtacagtcactacttcaagcacagacctgaaccataaaacacaagaaaattatagaggtggcttgcaaagtcagtctggaactgttgttacaacagaaatcaagactgaaaacaaagaaaaggatgaaaaccttcatgaacctccttcatcagatgacatgaagtcagatgatgaatcctcccaaaaagatatcaaggtttcatctagaggcagaacaagcagtactaatgaagatgaggatttgaaccctgaacagaagatagaaagggagaaggagaggcggatggctaacaatgccagagaacgcttacgcgtgcgggatattaatgaagcattcaaagagcttggccgaatgtgtcagcttcacttgaagagtgaaaaaccccaaacaaaactccttattcttcatcaagccgtggcagtcatccttagtctagaacagcaagtcagagagaggaaccttaaccccaaagcagcctgccttaagagaagggaagaagaaaaagtttctgccgtatcggcagagccgccaaccacactgccaggaacccatcctgggcttagtgaaactaccaaccctatgggtcatatgtaa
Sequence Length
2121
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,157 Da
NCBI Official Full Name
Homo sapiens transcription factor 12, mRNA
NCBI Official Synonym Full Names
transcription factor 12
NCBI Official Symbol
TCF12
NCBI Official Synonym Symbols
HEB; CRS3; HTF4; TCF-12; bHLHb20; HsT17266
NCBI Protein Information
transcription factor 12
UniProt Protein Name
Transcription factor 12
Protein Family
UniProt Gene Name
TCF12
UniProt Synonym Gene Names
BHLHB20; HEB; HTF4; TCF-12; bHLHb20
UniProt Entry Name
HTF4_HUMAN
NCBI Description
The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
TCF12 iso3: Binds specifically to oligomers of E-box motifs. May play important roles during development of the nervous system as well as in other organ systems. Efficient DNA binding requires dimerization with another bHLH protein. Forms homo- or hetero-oligomers with myogenin, E12 and ITF2 proteins. Interacts with PTF1A.
Protein type: DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: 15q21
Cellular Component: cytoplasm; nuclear chromatin; nucleus
Molecular Function: bHLH transcription factor binding; protein binding; protein heterodimerization activity; protein homodimerization activity; SMAD binding; transcription factor activity; transcription factor binding
Biological Process: immune response; muscle development; positive regulation of neuron differentiation; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription from RNA polymerase II promoter
Research Articles on TCF12
1. Studies suggest that transcription factor 12 (TCF12) should be included in level 2 genetic testing.
Similar Products
Product Notes
The TCF12 tcf12 (Catalog #AAA1268282) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcccc agcaacaacg catggccgct atagggaccg acaaggagct gagcgaccta ctggacttca gtgcgatgtt ttccccacct gttaatagtg ggaaaactag accaactaca ctgggaagca gtcagttcag tggatcaggt attgatgaaa gaggaggtac aacatcttgg ggaacaagtg gtcaaccaag tccttcctat gattcatcta gaggttttac agacagccct cattacagtg atcacttgaa tgacagtcga ttaggagccc atgaaggctt gtccccaaca cctttcatga actcaaatct gatgggaaaa acatcagaga gaggctcatt ttccctgtac agcagagata ctggattacc aggctgtcaa tctagtctcc tgagacaaga tctggggctt gggagcccag cacagctatc ttcttcagga aaacctggga cagcatacta ttcattctct gctacaagtt ccaggaggag accactccat gactctgcag cgcttgatcc cttgcaagca aaaaaagtca gaaaggtgcc tcctggtttg ccttcttctg tatatgcacc atccccaaat tcagatgatt tcaaccgtga atctcctagt tatccatctc ctaagccacc aaccagtatg ttcgctagca ctttctttat gcaagatggg acccacaatt cttctgacct ttggagttca tcaaatggga tgagccagcc tggttttggt ggaattctgg ggacctccac ttcccacatg tctcaatcca gtagttatgg caaccttcat tcacatgacc gcttgagtta tcctccacac tcagtttcac caacagacat aaacacgagt cttccaccaa tgtccagctt tcatcgcggc agtaccagca gttcacctta cgttgctgcc tcacacactc ctcccatcaa tggatcagac agcattctag gaaccagagg gaatgctgct ggaagctcac agacaggtga tgcacttgga aaggctttgg catctattta ttctcctgac cataccagca gtagttttcc gtcaaatcca tcaacaccag ttggatcacc ttcacctctc acaggtacca gtcagtggcc aagacctgga gggcaagcac cttcatcccc aagctatgaa aactcactcc actccctgaa aaatcgagtt gagcagcaac ttcacgagca tttgcaagat gcaatgtcct tcttaaagga tgtctgtgag cagtctcgaa tggaggatcg tttagacaga ctggatgatg caatccatgt gctgcggaac catgctgtgg gaccttccac cagtttgcct gctggtcaca gtgatataca tagtttattg ggaccatccc ataatgcacc aattggaagc ctcaattcaa actatggagg atcaagcctt gttgcaagca gtcgatcagc ttcaatggtt ggaactcatc gggaagactc tgtcagtctc aatggcaatc attcagtcct gtctagtaca gtcactactt caagcacaga cctgaaccat aaaacacaag aaaattatag aggtggcttg caaagtcagt ctggaactgt tgttacaaca gaaatcaaga ctgaaaacaa agaaaaggat gaaaaccttc atgaacctcc ttcatcagat gacatgaagt cagatgatga atcctcccaa aaagatatca aggtttcatc tagaggcaga acaagcagta ctaatgaaga tgaggatttg aaccctgaac agaagataga aagggagaag gagaggcgga tggctaacaa tgccagagaa cgcttacgcg tgcgggatat taatgaagca ttcaaagagc ttggccgaat gtgtcagctt cacttgaaga gtgaaaaacc ccaaacaaaa ctccttattc ttcatcaagc cgtggcagtc atccttagtc tagaacagca agtcagagag aggaacctta accccaaagc agcctgcctt aagagaaggg aagaagaaaa agtttctgcc gtatcggcag agccgccaac cacactgcca ggaacccatc ctgggcttag tgaaactacc aaccctatgg gtcatatgta a. It is sometimes possible for the material contained within the vial of "TCF12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
