ARL6IP4 cdna clone
ARL6IP4 cDNA Clone
Gene Names
ARL6IP4; SR-25; SRp25; SFRS20; SRrp37
Synonyms
ARL6IP4; ARL6IP4 cDNA Clone; ARL6IP4 cdna clone
Sequence
atggctcacgtcggctcccgcaagcgctcgaggagtcgcagccggtcccggggacgggggtcggaaaagagaaagaagaagagcaggaaagacacctcgaggaactgctcggcctccacatcccaagagagaagcaagcagaaggcccggaggagaacaagatccagctcctcctcctcttcttccagttcttctagctcctcttcttcctcctcgtcctcctcctcttcctccagtgatggccggaagaagcgggggaagtacaaggacaagaggaggaagaagaagaagaagaggaagaagctgaagaagaagggcaaggagaaggcggaagcacagcaggtggaggctctgccgggcccctcgctggaccagtggcaccgatcagctggggaggaagaggatggcccagtcctgacggatgagcagaagtcccgaatccaggccatgaagcccatgaccaaggaggagtgggatgcccggcagagcatcatccgcaaggtggtggaccctgagacggggcgcaccaggcttattaagggagatggcgaggtcctagaggaaatcgtaaccaaagaacgacacagagagatcaacaaggtgggtgtggcccctctgcctgccatccgcccccagctctgtttgtga
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,349 Da
NCBI Official Full Name
Homo sapiens ADP-ribosylation-like factor 6 interacting protein 4, mRNA
NCBI Official Synonym Full Names
ADP ribosylation factor like GTPase 6 interacting protein 4
NCBI Official Symbol
ARL6IP4
NCBI Official Synonym Symbols
SR-25; SRp25; SFRS20; SRrp37
NCBI Protein Information
ADP-ribosylation factor-like protein 6-interacting protein 4
UniProt Protein Name
ADP-ribosylation factor-like protein 6-interacting protein 4
Protein Family
UniProt Gene Name
ARL6IP4
UniProt Synonym Gene Names
ARL-6-interacting protein 4; Aip-4; SR-25
UniProt Entry Name
AR6P4_HUMAN
Uniprot Description
ARL6IP4: In case of infection by Herpes simplex virus (HSVI), may act as a splicing inhibitor of HSVI pre-mRNA. Belongs to the ARL6IP4 family. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: Nucleolus; Unknown function
Chromosomal Location of Human Ortholog: 12q24.31
Cellular Component: nucleus
Molecular Function: protein binding
Similar Products
Product Notes
The ARL6IP4 arl6ip4 (Catalog #AAA1268256) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcacg tcggctcccg caagcgctcg aggagtcgca gccggtcccg gggacggggg tcggaaaaga gaaagaagaa gagcaggaaa gacacctcga ggaactgctc ggcctccaca tcccaagaga gaagcaagca gaaggcccgg aggagaacaa gatccagctc ctcctcctct tcttccagtt cttctagctc ctcttcttcc tcctcgtcct cctcctcttc ctccagtgat ggccggaaga agcgggggaa gtacaaggac aagaggagga agaagaagaa gaagaggaag aagctgaaga agaagggcaa ggagaaggcg gaagcacagc aggtggaggc tctgccgggc ccctcgctgg accagtggca ccgatcagct ggggaggaag aggatggccc agtcctgacg gatgagcaga agtcccgaat ccaggccatg aagcccatga ccaaggagga gtgggatgcc cggcagagca tcatccgcaa ggtggtggac cctgagacgg ggcgcaccag gcttattaag ggagatggcg aggtcctaga ggaaatcgta accaaagaac gacacagaga gatcaacaag gtgggtgtgg cccctctgcc tgccatccgc ccccagctct gtttgtga. It is sometimes possible for the material contained within the vial of "ARL6IP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
