Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BACE1 cdna clone

BACE1 cDNA Clone

Gene Names
BACE1; ASP2; BACE; HSPC104
Synonyms
BACE1; BACE1 cDNA Clone; BACE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccaagccctgccctggctcctgctgtggatgggcgcgggagtgctgcctgcccacggcacccagcacggcatccggctgcccctgcgcagcggcctggggggcgcccccctggggctgcggctgccccgggagaccgacgaagagcccgaggagcccggccggaggggcagctttgtggagatggtggacaacctgaggggcaagtcggggcagggctactacgtggagatgaccgtgggcagccccccgcagacgctcaacatcctggtggatacaggcagcagtaactttgcagtgggtgctgccccccaccccttcctgcatcgctactaccagaggcagctgtccagcacataccgggacctccggaagggtgtgtatgtgccctacacccagggcaagtgggaaggggagctgggcaccgacctggtaagcatcccccatggccccaacgtcactgtgcgtgccaacattgctgccatcactgaatcagacaagttcttcatcaacggctccaactgggaaggcatcctggggctggcctatgctgagattgccaggcctgacgactccctggagcctttctttgactctctggtaaagcagacccacgttcccaacctcttctccctgcagctttgtggtgctggcttccccctcaaccagtctgaagtgctggcctctgtcggagggagcatgatcattggaggtatcgaccactcgctgtacacaggcagtctctggtatacacccatccggcgggagtggtattatgaggtgatcattgtgcgggtggagatcaatggacaggatctgaaaatggactgcaaggagtacaactatgacaagagcattgtggacagtggcaccaccaaccttcgtttgcccaagaaagtgtttgaagctgcagtcaaatccatcaaggcagcctcctccacggagaagttccctgatggtttctggctaggagagcagctggtgtgctggcaagcaggcaccaccccttggaacattttcccagtcatctcactctacctaatgggtgaggttaccaaccagtccttccgcatcaccatccttccgcagcaatacctgcggccagtggaagatgtggccacgtcccaagacgactgttacaagtttgccatctcacagtcatccacgggcactgttatgggagctgttatcatggagggcttctacgttgtctttgatcgggcccgaaaacgaattggctttgctgtcagcgcttgccatgtgcacgatgagttcaggacggcagcggtggaaggcccttttgtcaccttggacatggaagactgtggctacaacattccacagacagatgagtcaaccctcatgaccatagcctatgtcatggctgccatctgcgccctcttcatgctgccactctgcctcatggtgtgtcagtggcgctgcctccgctgcctgcgccagcagcatgatgactttgctgatgacatctccctgctgaagtga
Sequence Length
1506
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,107 Da
NCBI Official Full Name
Homo sapiens beta-site APP-cleaving enzyme 1, mRNA
NCBI Official Synonym Full Names
beta-secretase 1
NCBI Official Symbol
BACE1
NCBI Official Synonym Symbols
ASP2; BACE; HSPC104
NCBI Protein Information
beta-secretase 1
UniProt Protein Name
Beta-secretase 1
Protein Family
UniProt Gene Name
BACE1
UniProt Synonym Gene Names
BACE; KIAA1149; ASP2; Asp 2; Beta-site APP cleaving enzyme 1
UniProt Entry Name
BACE1_HUMAN

NCBI Description

This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. [provided by RefSeq, Nov 2015]

Uniprot Description

BACE: an integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi. Cleaves APP at the amino terminus of the A-beta peptide sequence, leading to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated carboxy-terminal fragment which is later release by gamma-secretase. Four splice-variant isoforms have been described.

Protein type: Protease; Membrane protein, integral; EC 3.4.23.46

Chromosomal Location of Human Ortholog: 11q23.2-q23.3

Cellular Component: endoplasmic reticulum lumen; endosome; endosome membrane; Golgi apparatus; integral to plasma membrane; late endosome; multivesicular body; plasma membrane; trans-Golgi network

Molecular Function: aspartic-type endopeptidase activity; beta-amyloid binding; beta-aspartyl-peptidase activity; enzyme binding; peptidase activity; protein binding

Biological Process: beta-amyloid metabolic process; cellular protein metabolic process; membrane protein ectodomain proteolysis; protein catabolic process; proteolysis

Research Articles on BACE1

Similar Products

Product Notes

The BACE1 bace1 (Catalog #AAA1268109) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccaag ccctgccctg gctcctgctg tggatgggcg cgggagtgct gcctgcccac ggcacccagc acggcatccg gctgcccctg cgcagcggcc tggggggcgc ccccctgggg ctgcggctgc cccgggagac cgacgaagag cccgaggagc ccggccggag gggcagcttt gtggagatgg tggacaacct gaggggcaag tcggggcagg gctactacgt ggagatgacc gtgggcagcc ccccgcagac gctcaacatc ctggtggata caggcagcag taactttgca gtgggtgctg ccccccaccc cttcctgcat cgctactacc agaggcagct gtccagcaca taccgggacc tccggaaggg tgtgtatgtg ccctacaccc agggcaagtg ggaaggggag ctgggcaccg acctggtaag catcccccat ggccccaacg tcactgtgcg tgccaacatt gctgccatca ctgaatcaga caagttcttc atcaacggct ccaactggga aggcatcctg gggctggcct atgctgagat tgccaggcct gacgactccc tggagccttt ctttgactct ctggtaaagc agacccacgt tcccaacctc ttctccctgc agctttgtgg tgctggcttc cccctcaacc agtctgaagt gctggcctct gtcggaggga gcatgatcat tggaggtatc gaccactcgc tgtacacagg cagtctctgg tatacaccca tccggcggga gtggtattat gaggtgatca ttgtgcgggt ggagatcaat ggacaggatc tgaaaatgga ctgcaaggag tacaactatg acaagagcat tgtggacagt ggcaccacca accttcgttt gcccaagaaa gtgtttgaag ctgcagtcaa atccatcaag gcagcctcct ccacggagaa gttccctgat ggtttctggc taggagagca gctggtgtgc tggcaagcag gcaccacccc ttggaacatt ttcccagtca tctcactcta cctaatgggt gaggttacca accagtcctt ccgcatcacc atccttccgc agcaatacct gcggccagtg gaagatgtgg ccacgtccca agacgactgt tacaagtttg ccatctcaca gtcatccacg ggcactgtta tgggagctgt tatcatggag ggcttctacg ttgtctttga tcgggcccga aaacgaattg gctttgctgt cagcgcttgc catgtgcacg atgagttcag gacggcagcg gtggaaggcc cttttgtcac cttggacatg gaagactgtg gctacaacat tccacagaca gatgagtcaa ccctcatgac catagcctat gtcatggctg ccatctgcgc cctcttcatg ctgccactct gcctcatggt gtgtcagtgg cgctgcctcc gctgcctgcg ccagcagcat gatgactttg ctgatgacat ctccctgctg aagtga. It is sometimes possible for the material contained within the vial of "BACE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.