HERC3 cdna clone
HERC3 cDNA Clone
Synonyms
HERC3; HERC3 cDNA Clone; HERC3 cdna clone
Sequence
atgttatgttggggatattggtctctgggccaacctggtatcagcaccaacctgcagggaattgtggctgagccccaggtgtgtgggttcatatctgacagaagtgtcaaggaagtggcctgtgggggaaaccactctgtgttcctgctggaagatggggaagtttacacatgtggtttgaacaccaaggggcaactgggccatgagagggaaggaaacaagccagaacaaattggagctctggcagatcagcatatcattcatgtggcatgtggcgagtcccacagtctggccctcagtgaccgaggccagctgttttcttggggtgcagggagtgatggtcagctaggactcatgactactgaggattctgtggcagtgcccaggttaatacaaaagctgaaccagcaaacaatattacaagtttcctgtggcaactggcattgcttggctcttgcggctgatggccagttcttcacctggggaaagaacagccatgggcagcttggcttagggaaggagttcccctcccaagccagcccacagagggtgaggtccctggaggggatcccactggctcaggtggctgccggaggggctcacagctttgccctgtctctctcaggagctgtttttggctgggggatgaataatgccgggcagctagggctcagtgatgaaaaagatcgagaatctccatgccatgtaaaactcttacgcacgcaaaaagttgtctatattagttgtggagaagaacacacagcagttctcacaaagagtggaggtgtgtttacctttggcgctggttcctgtgggcaacttggacacgactccatgaatgatgaggttaaccctagaagagttctagagctgatgggtagtgaagtaactcaaattgcttgtggcagacaacataccctagccttcgtgccttcttctggactcatctatgcatttggttgtggagcaagaggtcaattaggaactgggcacacttgtaatgttaagtgcccatctcctgtcaagggttactgggctgcccacagtggccagctttcagcccgagctggtaagaatgattgtctctggaatttaaaggtattttaa
Sequence Length
1107
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,051 Da
NCBI Official Full Name
Homo sapiens hect domain and RLD 3, mRNA
NCBI Official Synonym Full Names
HECT and RLD domain containing E3 ubiquitin protein ligase 3
NCBI Official Symbol
HERC3
NCBI Protein Information
probable E3 ubiquitin-protein ligase HERC3
UniProt Protein Name
Probable E3 ubiquitin-protein ligase HERC3
Protein Family
UniProt Gene Name
HERC3
UniProt Synonym Gene Names
KIAA0032
UniProt Entry Name
HERC3_HUMAN
NCBI Description
This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Uniprot Description
HERC3: E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates.
Protein type: Ubiquitin conjugating system; Ubiquitin ligase; Ligase; EC 6.3.2.19; EC 6.3.2.-
Chromosomal Location of Human Ortholog: 4q21
Cellular Component: cytoplasm; nucleus
Molecular Function: ubiquitin-protein ligase activity
Biological Process: protein ubiquitination during ubiquitin-dependent protein catabolic process
Research Articles on HERC3
Similar Products
Product Notes
The HERC3 herc3 (Catalog #AAA1268075) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttatgtt ggggatattg gtctctgggc caacctggta tcagcaccaa cctgcaggga attgtggctg agccccaggt gtgtgggttc atatctgaca gaagtgtcaa ggaagtggcc tgtgggggaa accactctgt gttcctgctg gaagatgggg aagtttacac atgtggtttg aacaccaagg ggcaactggg ccatgagagg gaaggaaaca agccagaaca aattggagct ctggcagatc agcatatcat tcatgtggca tgtggcgagt cccacagtct ggccctcagt gaccgaggcc agctgttttc ttggggtgca gggagtgatg gtcagctagg actcatgact actgaggatt ctgtggcagt gcccaggtta atacaaaagc tgaaccagca aacaatatta caagtttcct gtggcaactg gcattgcttg gctcttgcgg ctgatggcca gttcttcacc tggggaaaga acagccatgg gcagcttggc ttagggaagg agttcccctc ccaagccagc ccacagaggg tgaggtccct ggaggggatc ccactggctc aggtggctgc cggaggggct cacagctttg ccctgtctct ctcaggagct gtttttggct gggggatgaa taatgccggg cagctagggc tcagtgatga aaaagatcga gaatctccat gccatgtaaa actcttacgc acgcaaaaag ttgtctatat tagttgtgga gaagaacaca cagcagttct cacaaagagt ggaggtgtgt ttacctttgg cgctggttcc tgtgggcaac ttggacacga ctccatgaat gatgaggtta accctagaag agttctagag ctgatgggta gtgaagtaac tcaaattgct tgtggcagac aacataccct agccttcgtg ccttcttctg gactcatcta tgcatttggt tgtggagcaa gaggtcaatt aggaactggg cacacttgta atgttaagtg cccatctcct gtcaagggtt actgggctgc ccacagtggc cagctttcag cccgagctgg taagaatgat tgtctctgga atttaaaggt attttaa. It is sometimes possible for the material contained within the vial of "HERC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
