ZCCHC7 cdna clone
ZCCHC7 cDNA Clone
Gene Names
ZCCHC7; AIR1; HSPC086
Synonyms
ZCCHC7; ZCCHC7 cDNA Clone; ZCCHC7 cdna clone
Sequence
atgatgtttggtggctatgagactatagaagcatacgaagatgatctttatcgagatgagtcatctagtgaactgagtgttgatagtgaggtggaatttcaactctatagccaaattcattatgcccaagatcttgatgatgtcatcagggaggaagagcatgaagaaaagaactctgggaattcggaatctccgagtagtaaaccaaatcagaagaagctaatcgtcctttcagatagtgaggtcatccagctgtcagatgggtcagaggtcatcactttgtctgatgaagacagtatttatagatgtaaaggaaagaatgttagagttcaagcacaagaaaatgcccatggtctttcttcttctcttcaatctaatgagctggttgataagaaatgcaagagtgatattgagaagcctaaatctgaagagagatcaggtgtaatccgagaggtcatgattatagaggtcagttcaagtgaagaggaagagagcaccatttcagaaggtgataatgtggaaagctggatgctactgggatgtgaagtagatgataaagatgatgatatccttctcaaccttgtgggatgtgaaaactctgttactgaaggccaagaataa
Sequence Length
621
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,094 Da
NCBI Official Full Name
Homo sapiens zinc finger, CCHC domain containing 7, mRNA
NCBI Official Synonym Full Names
zinc finger CCHC-type containing 7
NCBI Official Symbol
ZCCHC7
NCBI Official Synonym Symbols
AIR1; HSPC086
NCBI Protein Information
zinc finger CCHC domain-containing protein 7
UniProt Protein Name
Zinc finger CCHC domain-containing protein 7
Protein Family
UniProt Gene Name
ZCCHC7
UniProt Entry Name
ZCHC7_HUMAN
Uniprot Description
ZCCHC7: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 9p13.2
Cellular Component: cytoplasm; nucleolus
Molecular Function: protein binding
Research Articles on ZCCHC7
Similar Products
Product Notes
The ZCCHC7 zcchc7 (Catalog #AAA1268068) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtttg gtggctatga gactatagaa gcatacgaag atgatcttta tcgagatgag tcatctagtg aactgagtgt tgatagtgag gtggaatttc aactctatag ccaaattcat tatgcccaag atcttgatga tgtcatcagg gaggaagagc atgaagaaaa gaactctggg aattcggaat ctccgagtag taaaccaaat cagaagaagc taatcgtcct ttcagatagt gaggtcatcc agctgtcaga tgggtcagag gtcatcactt tgtctgatga agacagtatt tatagatgta aaggaaagaa tgttagagtt caagcacaag aaaatgccca tggtctttct tcttctcttc aatctaatga gctggttgat aagaaatgca agagtgatat tgagaagcct aaatctgaag agagatcagg tgtaatccga gaggtcatga ttatagaggt cagttcaagt gaagaggaag agagcaccat ttcagaaggt gataatgtgg aaagctggat gctactggga tgtgaagtag atgataaaga tgatgatatc cttctcaacc ttgtgggatg tgaaaactct gttactgaag gccaagaata a. It is sometimes possible for the material contained within the vial of "ZCCHC7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
