Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB1B cdna clone

RAB1B cDNA Clone

Synonyms
RAB1B; RAB1B cDNA Clone; RAB1B cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctactaccggggggctcatggcatcatcgtggtgtatgacgtcactgaccaggaatcctacgccaacgtgaagcagtggctgcaggagattgaccgctatgccagcgagaacgtcaataagctcctggtgggcaacaagagcgacctcaccaccaagaaggtggtggacaacaccacagccaaggagtttgcagactctctgggcatccccttcttggagacgagcgccaagaatgccaccaatgtcgagcaggcgttcatgaccatggctgctgaaatcaaaaagcggatggggcctggagcagcctctgggggcgagcggcccaatctcaagatcgacagcacccctgtaaagccggctggcggtggctgttgctag
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,171 Da
NCBI Official Full Name
Homo sapiens RAB1B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB1B, member RAS oncogene family
NCBI Official Symbol
RAB1B
NCBI Protein Information
ras-related protein Rab-1B
UniProt Protein Name
Ras-related protein Rab-1B
Protein Family
UniProt Gene Name
RAB1B
UniProt Entry Name
RAB1B_HUMAN

NCBI Description

Members of the RAB protein family, such as RAB1B, are low molecular mass monomeric GTPases localized on the cytoplasmic surfaces of distinct membrane-bound organelles. RAB1B functions in the early secretory pathway and is essential for vesicle transport between the endoplasmic reticulum (ER) and Golgi (Chen et al., 1997 [PubMed 9030196]; Alvarez et al., 2003 [PubMed 12802079]).[supplied by OMIM, Jan 2009]

Uniprot Description

RAB1B: Protein transport. Regulates vesicular transport between the endoplasmic reticulum and successive Golgi compartments. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein; G protein, monomeric; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 11q12

Cellular Component: endoplasmic reticulum membrane; ER-Golgi intermediate compartment membrane; Golgi apparatus; Golgi membrane; pre-autophagosomal structure membrane; transport vesicle

Molecular Function: GTP binding; protein binding

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to ER; virus assembly

Research Articles on RAB1B

Similar Products

Product Notes

The RAB1B rab1b (Catalog #AAA1268060) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccccg aatatgacta cctgtttaag ctgcttttga ttggcgactc aggcgtgggc aagtcatgcc tgctcctgcg gtttgctgat gacacgtaca cagagagcta catcagcacc atcggggtgg acttcaagat ccgaaccatc gagctggatg gcaaaactat caaacttcag atctgggaca cagcgggcca ggaacggttc cggaccatca cttccagcta ctaccggggg gctcatggca tcatcgtggt gtatgacgtc actgaccagg aatcctacgc caacgtgaag cagtggctgc aggagattga ccgctatgcc agcgagaacg tcaataagct cctggtgggc aacaagagcg acctcaccac caagaaggtg gtggacaaca ccacagccaa ggagtttgca gactctctgg gcatcccctt cttggagacg agcgccaaga atgccaccaa tgtcgagcag gcgttcatga ccatggctgc tgaaatcaaa aagcggatgg ggcctggagc agcctctggg ggcgagcggc ccaatctcaa gatcgacagc acccctgtaa agccggctgg cggtggctgt tgctag. It is sometimes possible for the material contained within the vial of "RAB1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.