Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PGM1 cdna clone

PGM1 cDNA Clone

Gene Names
PGM1; CDG1T; GSD14
Synonyms
PGM1; PGM1 cDNA Clone; PGM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgaagatcgtgacagttaagacccaggcgtaccaggaccagaagccgggcacgagcgggctgcggaagcgggtgaaggtgttccagagcagcgccaactacgcggagaacttcatccagagtatcatctccaccgtggagccggcgcagcggcaggaggccacgctggtggtgggcggggacggccggttctacatgaaggaggccatccagctcatcgctcgcatcgctgccgccaacgggatcggtcgcttggttatcggacagaatggaatcctctccacccctgctgtatcctgcatcattagaaaaatcaaagccattggtgggatcattctgacagccagtcacaacccagggggccccaatggagattttggaatcaaattcaatatttctaatggaggtcctgctccagaagcaataactgataaaattttccaaatcagcaagacaattgaagaatatgcagtttgccctgacctgaaagtagaccttggtgttctgggaaagcagcagtttgacttggaaaataagttcaaacccttcacagtggaaattgtggattcggtagaagcttatgctacaatgctgagaagcatctttgatttcagtgcactgaaagaactactttctgggccaaaccgactgaagatccgtattgatgctatgcatggagttgtgggaccgtatgtaaagaagatcctctgtgaagaactcggtgcccctgcgaactcggcagttaactgcgttcctctggaggactttggaggccaccaccctgaccccaacctcacctatgcagctgacctggtggagaccatgaagtcaggagagcatgattttggggctgcctttgatggagatggggatcgaaacatgattctgggcaagcatgggttctttgtgaacccttcagactctgtggctgtcattgctgccaacatcttcagcattccgtatttccagcagactggggtccgcggctttgcacggagcatgcccacgagtggtgctctggaccgggtggctagtgctacaaagattgctttgtatgagaccccaactggctggaagttttttgggaatttgatggacgcgagcaaactgtccctttgtggggaggagagcttcgggaccggttctgaccacatccgtgagaaagatggactgtgggctgtccttgcctggctctccatcctagccacccgcaagcagagtgtggaggacattctcaaagatcattggcaaaagtatggccggaatttcttcaccaggtatgattacgaggaggtggaagctgagggcgcaaacaaaatgatgaaggacttggaggccctgatgtttgatcgctcctttgtggggaagcagttctcagcaaatgacaaagtttacactgtggagaaggccgataactttgaatacagcgacccagtggatggaagcatttcaagaaatcagggcttgcgcctcattttcacagatggttctcgaatcgtcttccgactgagcggcactgggagtgccggggccaccattcggctgtacatcgatagctatgagaaggacgttgccaagattaaccaggacccccaggtcatgttggccccccttatttccattgctctgaaagtgtcccagctgcaggagaggacgggacgcactgcacccactgtcatcacctaa
Sequence Length
1689
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,283 Da
NCBI Official Full Name
Homo sapiens phosphoglucomutase 1, mRNA
NCBI Official Synonym Full Names
phosphoglucomutase 1
NCBI Official Symbol
PGM1
NCBI Official Synonym Symbols
CDG1T; GSD14
NCBI Protein Information
phosphoglucomutase-1
UniProt Protein Name
Phosphoglucomutase-1
Protein Family
UniProt Gene Name
PGM1
UniProt Synonym Gene Names
PGM 1
UniProt Entry Name
PGM1_HUMAN

NCBI Description

The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]

Uniprot Description

PGM1: This enzyme participates in both the breakdown and synthesis of glucose. Defects in PGM1 are the cause of glycogen storage disease type 14 (GSD14). A metabolic disorder resulting in a myopathy characterized by exercise-induced intolerance with episodes of rhabdomyolysis, normal elevation of lactate, and hyperammonemia on a forearm-exercise test. Belongs to the phosphohexose mutase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - amino sugar and nucleotide sugar; Carbohydrate Metabolism - galactose; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Carbohydrate Metabolism - pentose phosphate pathway; Carbohydrate Metabolism - starch and sucrose; EC 5.4.2.2; Isomerase

Chromosomal Location of Human Ortholog: 1p31

Cellular Component: actin cytoskeleton; cytosol

Molecular Function: magnesium ion binding; phosphoglucomutase activity; protein binding

Biological Process: galactose catabolic process; gluconeogenesis; glucose metabolic process; glycogen biosynthetic process; glycogen catabolic process; glycolysis

Disease: Congenital Disorder Of Glycosylation, Type It

Research Articles on PGM1

Similar Products

Product Notes

The PGM1 pgm1 (Catalog #AAA1268042) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaaga tcgtgacagt taagacccag gcgtaccagg accagaagcc gggcacgagc gggctgcgga agcgggtgaa ggtgttccag agcagcgcca actacgcgga gaacttcatc cagagtatca tctccaccgt ggagccggcg cagcggcagg aggccacgct ggtggtgggc ggggacggcc ggttctacat gaaggaggcc atccagctca tcgctcgcat cgctgccgcc aacgggatcg gtcgcttggt tatcggacag aatggaatcc tctccacccc tgctgtatcc tgcatcatta gaaaaatcaa agccattggt gggatcattc tgacagccag tcacaaccca gggggcccca atggagattt tggaatcaaa ttcaatattt ctaatggagg tcctgctcca gaagcaataa ctgataaaat tttccaaatc agcaagacaa ttgaagaata tgcagtttgc cctgacctga aagtagacct tggtgttctg ggaaagcagc agtttgactt ggaaaataag ttcaaaccct tcacagtgga aattgtggat tcggtagaag cttatgctac aatgctgaga agcatctttg atttcagtgc actgaaagaa ctactttctg ggccaaaccg actgaagatc cgtattgatg ctatgcatgg agttgtggga ccgtatgtaa agaagatcct ctgtgaagaa ctcggtgccc ctgcgaactc ggcagttaac tgcgttcctc tggaggactt tggaggccac caccctgacc ccaacctcac ctatgcagct gacctggtgg agaccatgaa gtcaggagag catgattttg gggctgcctt tgatggagat ggggatcgaa acatgattct gggcaagcat gggttctttg tgaacccttc agactctgtg gctgtcattg ctgccaacat cttcagcatt ccgtatttcc agcagactgg ggtccgcggc tttgcacgga gcatgcccac gagtggtgct ctggaccggg tggctagtgc tacaaagatt gctttgtatg agaccccaac tggctggaag ttttttggga atttgatgga cgcgagcaaa ctgtcccttt gtggggagga gagcttcggg accggttctg accacatccg tgagaaagat ggactgtggg ctgtccttgc ctggctctcc atcctagcca cccgcaagca gagtgtggag gacattctca aagatcattg gcaaaagtat ggccggaatt tcttcaccag gtatgattac gaggaggtgg aagctgaggg cgcaaacaaa atgatgaagg acttggaggc cctgatgttt gatcgctcct ttgtggggaa gcagttctca gcaaatgaca aagtttacac tgtggagaag gccgataact ttgaatacag cgacccagtg gatggaagca tttcaagaaa tcagggcttg cgcctcattt tcacagatgg ttctcgaatc gtcttccgac tgagcggcac tgggagtgcc ggggccacca ttcggctgta catcgatagc tatgagaagg acgttgccaa gattaaccag gacccccagg tcatgttggc cccccttatt tccattgctc tgaaagtgtc ccagctgcag gagaggacgg gacgcactgc acccactgtc atcacctaa. It is sometimes possible for the material contained within the vial of "PGM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.