Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IQUB cdna clone

IQUB cDNA Clone

Synonyms
IQUB; IQUB cDNA Clone; IQUB cdna clone
Ordering
For Research Use Only!
Sequence
atgtctaatcaacaggagaagtatgaagctcagaatatagtcaattcaacagaagagagtgatgatgcttttgatactgtcactattccagttccctcagaagagcctcaagagtcagatcaaactgaagagcatgaatctggaatagaacaattcagtgagagccatgcaatacatgttgaggagcagagtgaccaaagcttttcaagcctggaaccagacaatgaacaactcatggaagaggttatatcaccaagacaagtttcatatactccgcaacatcatgaaaagcaatatgcaatgcagaggccaaatgatgatagtttggcatttctggataaaataaagtctgtaaaggaatctttgcaagaatcagtggaagattctctagcaacagtaaaagttgtacttattccagtgggccaggaaattgtaataccttttaaggttgataccattcttaaatatcttaaggaccatttttcacacttattaggtatcccacattctgtactgcagataagatactcaggaaaaattcttaaaaataatgagactctagtacaacatggagttaagccacaggaaattgtacaagtggaaatcttttctacaaatccagatctgtatccagtcagaagaatagatggattaactgatgtctctcaaatcataactgtcactgtccaaactggacttgatcaataccagcaggtacctgttgagattgtcaaatctgactttcacaaaccatttcttggtggattcagacataaagtaacaggagtagagtatcacaatgctggaacacaaactgtacctaaaaggattcccgaaagactcagtatattttgtagggatacgcagacagtttttcagaaaaaaaatctccaacaaactacaaatacaacatccacacagatgactaacattggtgtatatgtatcaaatatgactgataaactggtaacaccaggaaagtatttttcagcagcagaataccatgctcaaagactaaaggcggtgatagtgatacagacttactacaggcaatggcatgctaaaatcttcgtagagaatttaagaagacagaaaagcttaagactggaatgggaaacatag
Sequence Length
1122
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,382 Da
NCBI Official Full Name
Homo sapiens IQ motif and ubiquitin domain containing, mRNA
NCBI Official Synonym Full Names
IQ motif and ubiquitin domain containing
NCBI Official Symbol
IQUB
NCBI Protein Information
IQ and ubiquitin-like domain-containing protein
UniProt Protein Name
IQ and ubiquitin-like domain-containing protein
UniProt Gene Name
IQUB
UniProt Entry Name
IQUB_HUMAN

Uniprot Description

IQUB: May play roles in cilia formation and/or maintenance. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 7q31.32

Molecular Function: protein binding

Research Articles on IQUB

Similar Products

Product Notes

The IQUB iqub (Catalog #AAA1268023) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctaatc aacaggagaa gtatgaagct cagaatatag tcaattcaac agaagagagt gatgatgctt ttgatactgt cactattcca gttccctcag aagagcctca agagtcagat caaactgaag agcatgaatc tggaatagaa caattcagtg agagccatgc aatacatgtt gaggagcaga gtgaccaaag cttttcaagc ctggaaccag acaatgaaca actcatggaa gaggttatat caccaagaca agtttcatat actccgcaac atcatgaaaa gcaatatgca atgcagaggc caaatgatga tagtttggca tttctggata aaataaagtc tgtaaaggaa tctttgcaag aatcagtgga agattctcta gcaacagtaa aagttgtact tattccagtg ggccaggaaa ttgtaatacc ttttaaggtt gataccattc ttaaatatct taaggaccat ttttcacact tattaggtat cccacattct gtactgcaga taagatactc aggaaaaatt cttaaaaata atgagactct agtacaacat ggagttaagc cacaggaaat tgtacaagtg gaaatctttt ctacaaatcc agatctgtat ccagtcagaa gaatagatgg attaactgat gtctctcaaa tcataactgt cactgtccaa actggacttg atcaatacca gcaggtacct gttgagattg tcaaatctga ctttcacaaa ccatttcttg gtggattcag acataaagta acaggagtag agtatcacaa tgctggaaca caaactgtac ctaaaaggat tcccgaaaga ctcagtatat tttgtaggga tacgcagaca gtttttcaga aaaaaaatct ccaacaaact acaaatacaa catccacaca gatgactaac attggtgtat atgtatcaaa tatgactgat aaactggtaa caccaggaaa gtatttttca gcagcagaat accatgctca aagactaaag gcggtgatag tgatacagac ttactacagg caatggcatg ctaaaatctt cgtagagaat ttaagaagac agaaaagctt aagactggaa tgggaaacat ag. It is sometimes possible for the material contained within the vial of "IQUB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.