Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CSPP1 cdna clone

CSPP1 cDNA Clone

Gene Names
CSPP1; CSPP; JBTS21
Synonyms
CSPP1; CSPP1 cDNA Clone; CSPP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagacagccttctcctatagttcctgctcttcagaacaaaattgcaagcaaactccaaagacctccttcagttgacagcatcatacattcctttattcatgaaagttccatgtccagggcacagtcacccccggtacctgccaggaaaaatcagctccgtgcagaagaggagaaaaaaaatgtaattatggaattatcagaaatgagaaaacagcttcgtagtgaagagaggcgtctacaagagcgattgctacacatggacagcgatgatgaaattcctatcaggaaaaaggaaaggaatcccatggatatatttgatatggctagacatcggttgcaagctcctgtcagaagacagtcccctaagggcttagacgctgccacttttcagaatgttcatgattttaatgagctgaaagatagagattcagaaacacgagttgatctgaaatttatgtacctggatcctccaagagatcatcacaccttagagattcagcagcaagccctgctaagagagcagcagaagaggctgaacagaataaaaatgcaggaaggtgccaaagttgacttagatgccatcccaagtgctaaagtacgagagcaaagaatgcccagagatgacactagtgatttcttgaaaaactcattattggaatctgatagtgcttttattggggcttacggtgagacatatcctgccattgaagatgacgtcctccctccaccatcacagttgccctctgcacgggagcgcaggaggaacaaacggaaaggactagacattgatagcagtcgtcctaatgtagcaccagatggtctctctctaaaatctatatccagtgtaaatgttgatgagcttagagtgagaaatgaggaacgaatgcgaagactgaatgaatttcacaataaacctattaatacagatgatgagagttcactggttgaccctgatgacatcatgaaacacataggggatgacggatcaaactctgtagcaactgagccctggctccgccctggcacttcagaaacgctgaaacgtttcatggcagagcagctgaaccaggagcagcagcagattcctggaaaaccaggcactttcacttggcagggcctgtcgactgcacatggttaa
Sequence Length
1140
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
101,555 Da
NCBI Official Full Name
Homo sapiens centrosome and spindle pole associated protein 1, mRNA
NCBI Official Synonym Full Names
centrosome and spindle pole associated protein 1
NCBI Official Symbol
CSPP1
NCBI Official Synonym Symbols
CSPP; JBTS21
NCBI Protein Information
centrosome and spindle pole-associated protein 1
UniProt Protein Name
Centrosome and spindle pole-associated protein 1
UniProt Gene Name
CSPP1
UniProt Synonym Gene Names
CSPP
UniProt Entry Name
CSPP1_HUMAN

NCBI Description

This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]

Uniprot Description

CSPP1: May play a role in cell-cycle-dependent microtubule organization. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 8q13.2

Cellular Component: centrosome; microtubule organizing center; spindle; spindle pole

Biological Process: positive regulation of cell division; positive regulation of cytokinesis

Disease: Joubert Syndrome 21

Research Articles on CSPP1

Similar Products

Product Notes

The CSPP1 cspp1 (Catalog #AAA1267979) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagacagc cttctcctat agttcctgct cttcagaaca aaattgcaag caaactccaa agacctcctt cagttgacag catcatacat tcctttattc atgaaagttc catgtccagg gcacagtcac ccccggtacc tgccaggaaa aatcagctcc gtgcagaaga ggagaaaaaa aatgtaatta tggaattatc agaaatgaga aaacagcttc gtagtgaaga gaggcgtcta caagagcgat tgctacacat ggacagcgat gatgaaattc ctatcaggaa aaaggaaagg aatcccatgg atatatttga tatggctaga catcggttgc aagctcctgt cagaagacag tcccctaagg gcttagacgc tgccactttt cagaatgttc atgattttaa tgagctgaaa gatagagatt cagaaacacg agttgatctg aaatttatgt acctggatcc tccaagagat catcacacct tagagattca gcagcaagcc ctgctaagag agcagcagaa gaggctgaac agaataaaaa tgcaggaagg tgccaaagtt gacttagatg ccatcccaag tgctaaagta cgagagcaaa gaatgcccag agatgacact agtgatttct tgaaaaactc attattggaa tctgatagtg cttttattgg ggcttacggt gagacatatc ctgccattga agatgacgtc ctccctccac catcacagtt gccctctgca cgggagcgca ggaggaacaa acggaaagga ctagacattg atagcagtcg tcctaatgta gcaccagatg gtctctctct aaaatctata tccagtgtaa atgttgatga gcttagagtg agaaatgagg aacgaatgcg aagactgaat gaatttcaca ataaacctat taatacagat gatgagagtt cactggttga ccctgatgac atcatgaaac acatagggga tgacggatca aactctgtag caactgagcc ctggctccgc cctggcactt cagaaacgct gaaacgtttc atggcagagc agctgaacca ggagcagcag cagattcctg gaaaaccagg cactttcact tggcagggcc tgtcgactgc acatggttaa. It is sometimes possible for the material contained within the vial of "CSPP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.