Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WWP1 cdna clone

WWP1 cDNA Clone

Gene Names
WWP1; AIP5; Tiul1; hSDRP1
Synonyms
WWP1; WWP1 cDNA Clone; WWP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccactgcttcaccaaggtctgatactagtaataaccacagtggaaggttgcagttacaggtaactgtttctagtgccaaacttaaaagaaaaaagaactggttcggaacagcaatatatacagaagtagttgtagatggagaaattacgaaaacagcaaaatccagtagttcttctaatccaaaatgggatgaacagctaactgtaaatgttacgccacagactacattggaatttcaagtttggagccatcgcactttaaaagcagatgctttattaggaaaagcaacgatagatttgaaacaagctctgttgatacacaatagaaaattggaaagagtgaaagaacaattaaaactttccttggaaaacaagaatggcatagcacaaactggtgaattgacagttgtgcttgatggattggtgattgagcaagaaaatataacaaactgcagctcatctccaaccatagaaatacaggaaaatggtgatgccttacatgaaaatggagagccttcagcaaggacaactgccaggttggctgttgaaggcacgaatggaatagataatcatgtacctacaagcactctagtccaaaactcatgctgctcgtatgtagttaatggagacaacacaccttcatctccgtctcaggttgctgccagacccaaaaatacaccagctccaaaaccactcgcatctgagcctgccgatgacactgttaatggagaatcatcctcatttgcaccaactgataatgcgtctgtcacgggtactccagtagtgtctgaagaaaatgccttgtctccaaattgcactagtactactgttgaagatcctccagttcaagaaatactgacttcctcagaaaacaatgaatgtattccttctaccagtgcagaattggaatctgaagctagaagtatattagagcctgacacctctaattctagaagtagttctgcttttgaagcagccaaatcaagacagccagatgggtgtatggatcctgtacggcagcagtctgggaatgccaacacagaaaccttgccatcagggtgggaacaaagaaaagatcctcatggtagaacctattatgtggatcataatactcgaactaccacatgggagagaccacaacctttacctccaggttgggaaagaagagttgatgatcgtagaagagtttattatgtggatcataacaccagaacaacaacgtggcagcggcctaccatggaatctgtccgaaattttgaacagtggcaatctcagcggaaccaattgcagggagctatgcaacagtttaaccaacgatacctctattcggcttcaatgttagctgcagaaaatgacccttatggacctttgccaccaggctgggaaaaaagagtggattcaacagacagggtttactttgtgaatcataacacaaaaacaacccagtgggaagatccaagaactcaaggcttacagaatgaagaacccctgccagaaggctgggaaattagatatactcgtgaaggtgtaaggtactttgttgatcataacacaagaacaacaacattcaaagatcctcgcaatgggaagtcatctgtaactaaaggtggtccacaaattgcttatgaacgcggctttaggtggaagcttgctcacttccgttatttgtgccagtctaatgcactacctagtcatgtaaagatcaatgtgtcccggcagacattgtttgaagattccttccaacagattatggcattaaaaccctatgacttgaggaggcgcttatatgtaatatttagaggagaagaaggacttgattatggtggcctagcgagagaatggtttttcttgctttcacatgaagttttgaacccaatgtattgcttatttgagtatgcgggcaagaacaactattgtctgcagataaatccagcatcaaccattaatccagaccatctttcatacttctgtttcattggtcgttttattgccatggcactatttcatggaaagtttatcgatactggtttctctttaccattctacaagcgtatgttaagtaaaaaacttactattaaggatttggaatctattgatactgaattttataactcccttatctggataagagataacaacattgaagaatgtggcttagaaatgtacttttctgttgacatggagattttgggaaaagttacttcacatgacctgaagttgggaggttccaatattctggtgactgaggagaacaaagatgaatatattggtttaatgacagaatggcgtttttctcgaggagtacaagaacagaccaaagctttccttgatggttttaatgaagttgttcctcttcagtggctacagtacttcgatgaaaaagaattagaggttatgttgtgtggcatgcaggaggttgacttggcagattggcagagaaatactgtttatcgacattatacaagaaacagcaagcaaatcatttggttttggcagtttgtgaaagagacagacaatgaagtaagaatgcgactattgcagttcgtcactggaacctgccgtttacctctaggaggatttgctgagctcatgggaagtaatgggcctcaaaagttttgcattgaaaaagttggcaaagacacttggttaccaagaagccatacatgttttaatcgcttggatctaccaccatataagagttatgaacaactaaaggaaaaacttctttttgcaatagaagagacagagggatttggacaagaatga
Sequence Length
2769
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens WW domain containing E3 ubiquitin protein ligase 1, mRNA
NCBI Official Synonym Full Names
WW domain containing E3 ubiquitin protein ligase 1
NCBI Official Symbol
WWP1
NCBI Official Synonym Symbols
AIP5; Tiul1; hSDRP1
NCBI Protein Information
NEDD4-like E3 ubiquitin-protein ligase WWP1
UniProt Protein Name
NEDD4-like E3 ubiquitin-protein ligase WWP1
UniProt Gene Name
WWP1
UniProt Synonym Gene Names
AIP5; Tiul1
UniProt Entry Name
WWP1_HUMAN

NCBI Description

WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]

Uniprot Description

WWP1: E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Ubiquitinates ERBB4 isoforms JM-A CYT-1 and JM-B CYT-1, KLF2, KLF5 and TP63 and promotes their proteasomal degradation. Ubiquitinates RNF11 without targeting it for degradation. Ubiquitinates and promotes degradation of TGFBR1; the ubiquitination is enhanced by SMAD7. Ubiquitinates SMAD6 and SMAD7. Ubiquitinates and promotes degradation of SMAD2 in response to TGF-beta signaling, which requires interaction with TGIF. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.19; Ligase

Chromosomal Location of Human Ortholog: 8q21

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: entry of virus into host cell; negative regulation of transcription, DNA-dependent; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on WWP1

Similar Products

Product Notes

The WWP1 wwp1 (Catalog #AAA1267912) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccactg cttcaccaag gtctgatact agtaataacc acagtggaag gttgcagtta caggtaactg tttctagtgc caaacttaaa agaaaaaaga actggttcgg aacagcaata tatacagaag tagttgtaga tggagaaatt acgaaaacag caaaatccag tagttcttct aatccaaaat gggatgaaca gctaactgta aatgttacgc cacagactac attggaattt caagtttgga gccatcgcac tttaaaagca gatgctttat taggaaaagc aacgatagat ttgaaacaag ctctgttgat acacaataga aaattggaaa gagtgaaaga acaattaaaa ctttccttgg aaaacaagaa tggcatagca caaactggtg aattgacagt tgtgcttgat ggattggtga ttgagcaaga aaatataaca aactgcagct catctccaac catagaaata caggaaaatg gtgatgcctt acatgaaaat ggagagcctt cagcaaggac aactgccagg ttggctgttg aaggcacgaa tggaatagat aatcatgtac ctacaagcac tctagtccaa aactcatgct gctcgtatgt agttaatgga gacaacacac cttcatctcc gtctcaggtt gctgccagac ccaaaaatac accagctcca aaaccactcg catctgagcc tgccgatgac actgttaatg gagaatcatc ctcatttgca ccaactgata atgcgtctgt cacgggtact ccagtagtgt ctgaagaaaa tgccttgtct ccaaattgca ctagtactac tgttgaagat cctccagttc aagaaatact gacttcctca gaaaacaatg aatgtattcc ttctaccagt gcagaattgg aatctgaagc tagaagtata ttagagcctg acacctctaa ttctagaagt agttctgctt ttgaagcagc caaatcaaga cagccagatg ggtgtatgga tcctgtacgg cagcagtctg ggaatgccaa cacagaaacc ttgccatcag ggtgggaaca aagaaaagat cctcatggta gaacctatta tgtggatcat aatactcgaa ctaccacatg ggagagacca caacctttac ctccaggttg ggaaagaaga gttgatgatc gtagaagagt ttattatgtg gatcataaca ccagaacaac aacgtggcag cggcctacca tggaatctgt ccgaaatttt gaacagtggc aatctcagcg gaaccaattg cagggagcta tgcaacagtt taaccaacga tacctctatt cggcttcaat gttagctgca gaaaatgacc cttatggacc tttgccacca ggctgggaaa aaagagtgga ttcaacagac agggtttact ttgtgaatca taacacaaaa acaacccagt gggaagatcc aagaactcaa ggcttacaga atgaagaacc cctgccagaa ggctgggaaa ttagatatac tcgtgaaggt gtaaggtact ttgttgatca taacacaaga acaacaacat tcaaagatcc tcgcaatggg aagtcatctg taactaaagg tggtccacaa attgcttatg aacgcggctt taggtggaag cttgctcact tccgttattt gtgccagtct aatgcactac ctagtcatgt aaagatcaat gtgtcccggc agacattgtt tgaagattcc ttccaacaga ttatggcatt aaaaccctat gacttgagga ggcgcttata tgtaatattt agaggagaag aaggacttga ttatggtggc ctagcgagag aatggttttt cttgctttca catgaagttt tgaacccaat gtattgctta tttgagtatg cgggcaagaa caactattgt ctgcagataa atccagcatc aaccattaat ccagaccatc tttcatactt ctgtttcatt ggtcgtttta ttgccatggc actatttcat ggaaagttta tcgatactgg tttctcttta ccattctaca agcgtatgtt aagtaaaaaa cttactatta aggatttgga atctattgat actgaatttt ataactccct tatctggata agagataaca acattgaaga atgtggctta gaaatgtact tttctgttga catggagatt ttgggaaaag ttacttcaca tgacctgaag ttgggaggtt ccaatattct ggtgactgag gagaacaaag atgaatatat tggtttaatg acagaatggc gtttttctcg aggagtacaa gaacagacca aagctttcct tgatggtttt aatgaagttg ttcctcttca gtggctacag tacttcgatg aaaaagaatt agaggttatg ttgtgtggca tgcaggaggt tgacttggca gattggcaga gaaatactgt ttatcgacat tatacaagaa acagcaagca aatcatttgg ttttggcagt ttgtgaaaga gacagacaat gaagtaagaa tgcgactatt gcagttcgtc actggaacct gccgtttacc tctaggagga tttgctgagc tcatgggaag taatgggcct caaaagtttt gcattgaaaa agttggcaaa gacacttggt taccaagaag ccatacatgt tttaatcgct tggatctacc accatataag agttatgaac aactaaagga aaaacttctt tttgcaatag aagagacaga gggatttgga caagaatga. It is sometimes possible for the material contained within the vial of "WWP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.