STAT6 cdna clone
STAT6 cDNA Clone
Gene Names
STAT6; STAT6B; STAT6C; D12S1644; IL-4-STAT
Synonyms
STAT6; STAT6 cDNA Clone; STAT6 cdna clone
Sequence
atgtctctgtggggtctggtctccaagatgcccccagaaaaagtgcagcggctctatgtcgactttccccaacacctgcggcatcttctgggtgactggctggagagccagccctgggagttcctggtcggctccgacgccttctgctgcaacttggctagtgccctactttcagacactgtccagcaccttcaggcctcggtgggagagcagggggaggggagcaccatcttgcaacacatcagcacccttgagagcatatatcagagggaccccctgaagctggtggccactttcagacaaatacttcaaggagagaaaaaagctgttatggaacagttccgccacttgccaatgcctttccactggaagcaggaagaactcaagtttaagacaggcttgcggaggctgcagcaccgagtaggggagatccaccttctccgagaagccctgcagaagggggctgaggctggccaagtgtctctgcacagcttgatagaaactcctgctaatgggactgggccaagtgaggccctggccatgctactgcaggagaccactggagagctagaggcagccaaagccctagtgctgaagaggatccagatttggaaacggcagcagcagctggcagggaatggcgcaccgtttgaggagagcctggccccactccaggagaggtgtgaaagcctggtggacatttattcccagctacagcaggaggtaggggcggctggtggggagcttgagcccaagacccgggcatcgctgactggccggctggatgaagtcctgagaaccctcgtcaccagttgcttcctggtggagaagcagcccccccaggtactgaagactcagaccaagttccaggctggagttcgattcctgttgggcttgaggttcctgggggccccagccaagcctccgctggtcagggccgacatggtgacagagaagcaggcgcgggagctgagtgtgcctcagggtcctggggctggagcagaaagcactggagaaatcatcaacaacactgtgcccttggagaacagcattcctgggaactgctgctctgccctgttcaagaacctgcttctcaagaagatcaagcggtgtgagcggaagggcactgagtctgtcacagaggagaagtgcgctgtgctcttctctgccagcttcacacttggccccggcaaactccccatccagctccaggccctgtctctgcccctggtggtcatcgtccatggcaaccaagacaacaatgccaaagccactatcctgtgggacaatgccttctctgagatggaccgcgtgccctttgtggtggctgagcgggtgccctgggagaagatgtgtgaaactctgaacctgaagttcatggctgaggtggggaccaaccgggggctgctcccagagcacttcctcttcctggcccagaagatcttcaatgacaacagcctcagtatggaggccttccagcaccgttctgtgtcctggtcgcagttcaacaaggagatcctgctgggccgtggcttcaccttttggcagtggtttgatggtgtcctggacctcaccaaacgctgtctccggagctactggtctgaccggctgatcattggcttcatcagcaaacagtacgttactagccttcttctcaatgagcccgacggaacctttctcctccgcttcagcgactcagagattgggggcatcaccattgcccatgtcatccggggccaggatggctctccacagatagagaacatccagccattctctgccaaagacctgtccattcgctcactgggggaccgaatccgggatcttgctcagctcaaaaatctctatcccaagaagcccaaggatgaggctttccggagccactacaagcctgaacagatgggtaaggatggcaggggttatgtcccagctaccatcaagatgaccgtggaaagggaccaaccacttcctaccccagagctccagatgcctaccatggtgccttcttatgaccttggaatggcccctgattcctccatgagcatgcagcttggcccagatatggtgccccaggtgtacccaccacactctcactccatccccccgtatcaaggcctctccccagaagaatcagtcaacgtgttgtcagccttccaggagcctcacctgcagatgccccccagcctgggccagatgagcctgccctttgaccagcctcacccccagggcctgctgccgtgccagcctcaggagcatgctgtgtccagccctgaccccctgctctgctcagatgtgaccatggtggaagacagctgcctgagccagccagtgacagcgtttcctcagggcacttggattggtgaagacatattccctcctctgctgcctcccactgaacaggacctcactaagcttctcctggaggggcaaggggagtcggggggagggtccttgggggcacagcccctcctgcagccctcccactatgggcaatctgggatctcaatgtcccacatggacctaagggccaaccccagttggtga
Sequence Length
2544
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
81,748 Da
NCBI Official Full Name
Homo sapiens signal transducer and activator of transcription 6, interleukin-4 induced, mRNA
NCBI Official Synonym Full Names
signal transducer and activator of transcription 6
NCBI Official Symbol
STAT6
NCBI Official Synonym Symbols
STAT6B; STAT6C; D12S1644; IL-4-STAT
NCBI Protein Information
signal transducer and activator of transcription 6
UniProt Protein Name
Signal transducer and activator of transcription 6
Protein Family
UniProt Gene Name
STAT6
UniProt Entry Name
STAT6_HUMAN
NCBI Description
The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Uniprot Description
STAT6: transcription factor of the STAT family. Plays a central role in IL4-mediated biological responses. Induces the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. May function in the differentiation of T helper 2 cells and class switch of immunoglobulins. Forms homo- or heterodimers that translocate into the nucleus where they regulate transcription.
Protein type: DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: 12q13
Cellular Component: cytoplasm; cytosol; nucleoplasm
Molecular Function: identical protein binding; protein binding; protein phosphatase binding
Biological Process: positive regulation of interferon type I production; regulation of transcription from RNA polymerase II promoter; signal transduction
Research Articles on STAT6
Similar Products
Product Notes
The STAT6 stat6 (Catalog #AAA1267903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctgt ggggtctggt ctccaagatg cccccagaaa aagtgcagcg gctctatgtc gactttcccc aacacctgcg gcatcttctg ggtgactggc tggagagcca gccctgggag ttcctggtcg gctccgacgc cttctgctgc aacttggcta gtgccctact ttcagacact gtccagcacc ttcaggcctc ggtgggagag cagggggagg ggagcaccat cttgcaacac atcagcaccc ttgagagcat atatcagagg gaccccctga agctggtggc cactttcaga caaatacttc aaggagagaa aaaagctgtt atggaacagt tccgccactt gccaatgcct ttccactgga agcaggaaga actcaagttt aagacaggct tgcggaggct gcagcaccga gtaggggaga tccaccttct ccgagaagcc ctgcagaagg gggctgaggc tggccaagtg tctctgcaca gcttgataga aactcctgct aatgggactg ggccaagtga ggccctggcc atgctactgc aggagaccac tggagagcta gaggcagcca aagccctagt gctgaagagg atccagattt ggaaacggca gcagcagctg gcagggaatg gcgcaccgtt tgaggagagc ctggccccac tccaggagag gtgtgaaagc ctggtggaca tttattccca gctacagcag gaggtagggg cggctggtgg ggagcttgag cccaagaccc gggcatcgct gactggccgg ctggatgaag tcctgagaac cctcgtcacc agttgcttcc tggtggagaa gcagcccccc caggtactga agactcagac caagttccag gctggagttc gattcctgtt gggcttgagg ttcctggggg ccccagccaa gcctccgctg gtcagggccg acatggtgac agagaagcag gcgcgggagc tgagtgtgcc tcagggtcct ggggctggag cagaaagcac tggagaaatc atcaacaaca ctgtgccctt ggagaacagc attcctggga actgctgctc tgccctgttc aagaacctgc ttctcaagaa gatcaagcgg tgtgagcgga agggcactga gtctgtcaca gaggagaagt gcgctgtgct cttctctgcc agcttcacac ttggccccgg caaactcccc atccagctcc aggccctgtc tctgcccctg gtggtcatcg tccatggcaa ccaagacaac aatgccaaag ccactatcct gtgggacaat gccttctctg agatggaccg cgtgcccttt gtggtggctg agcgggtgcc ctgggagaag atgtgtgaaa ctctgaacct gaagttcatg gctgaggtgg ggaccaaccg ggggctgctc ccagagcact tcctcttcct ggcccagaag atcttcaatg acaacagcct cagtatggag gccttccagc accgttctgt gtcctggtcg cagttcaaca aggagatcct gctgggccgt ggcttcacct tttggcagtg gtttgatggt gtcctggacc tcaccaaacg ctgtctccgg agctactggt ctgaccggct gatcattggc ttcatcagca aacagtacgt tactagcctt cttctcaatg agcccgacgg aacctttctc ctccgcttca gcgactcaga gattgggggc atcaccattg cccatgtcat ccggggccag gatggctctc cacagataga gaacatccag ccattctctg ccaaagacct gtccattcgc tcactggggg accgaatccg ggatcttgct cagctcaaaa atctctatcc caagaagccc aaggatgagg ctttccggag ccactacaag cctgaacaga tgggtaagga tggcaggggt tatgtcccag ctaccatcaa gatgaccgtg gaaagggacc aaccacttcc taccccagag ctccagatgc ctaccatggt gccttcttat gaccttggaa tggcccctga ttcctccatg agcatgcagc ttggcccaga tatggtgccc caggtgtacc caccacactc tcactccatc cccccgtatc aaggcctctc cccagaagaa tcagtcaacg tgttgtcagc cttccaggag cctcacctgc agatgccccc cagcctgggc cagatgagcc tgccctttga ccagcctcac ccccagggcc tgctgccgtg ccagcctcag gagcatgctg tgtccagccc tgaccccctg ctctgctcag atgtgaccat ggtggaagac agctgcctga gccagccagt gacagcgttt cctcagggca cttggattgg tgaagacata ttccctcctc tgctgcctcc cactgaacag gacctcacta agcttctcct ggaggggcaa ggggagtcgg ggggagggtc cttgggggca cagcccctcc tgcagccctc ccactatggg caatctggga tctcaatgtc ccacatggac ctaagggcca accccagttg gtga. It is sometimes possible for the material contained within the vial of "STAT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
