Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLHL35 cdna clone

KLHL35 cDNA Clone

Synonyms
KLHL35; KLHL35 cDNA Clone; KLHL35 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgctgggtgcgccacgacgcgccggcccgccgcggccagctgcgacgcctgctggagcacgtgcgcctgccgctactggcgcccgcttacttcctggagaaggtggaggcggacgagctgctgcaggcctgcggcgagtgccgcccgctgctgctcgaggctcgcgcctgcttcatcctgggccgcgaggccggtgcgctgcggacccggccgcggagattcatggacctagctgaagtgatcgtggtcatcggcggttgcgaccgcaaaggtctcctgaagctgcccttcgccgatgcctaccatccagagagccagcggtggaccccactgcccagcctgcccggctacactcgctcagaattcgccgcctgtgctctccgcaatgacgtctacgtctccggaggccacatcaacagtcatgatgtgtggatgtttagctcccatctgcacacctggatcaaggtagcctctctgcacaagggcaggtggaggcacaagatggcagttgtgcaggggcagctgttcgcggtgggtggcttcgacggcctgaggcgcctgcacagcgtggagcgctacgaccccttctccaacacctgggcggccgccgcgcccctcccggaggccgtgagctcggcggcggtggcgtcctgcgcgggcaagctcttcgtgattgggggcgccaggcagggcggcgtcaacacggacaaggtgcagtgctttgaccccaaggaggaccggtggagcctgcggtcaccagcacccttctcacagcggtgtctcgaggctgtctcccttgaggacaccatctatgtcatggggggtctcatgagcaaaatcttcacctatgatccaggcacagatgtgtggggggaggcagctgtcctccccagccctgtggaaagctgtggagtcactgtgtgtgacgggaaggtccacatccttggcgggcgggatgatcgcggagaaagcaccgataaggtcttcacctttgaccccagcagtgggcaggtggaggtccagccatccctgcagcgctgcaccagctcccacggctgtgtcaccatcatccagagcttgggcaggtga
Sequence Length
1092
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,467 Da
NCBI Official Full Name
Homo sapiens kelch-like 35 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 35
NCBI Official Symbol
KLHL35
NCBI Protein Information
kelch-like protein 35
UniProt Protein Name
Kelch-like protein 35
Protein Family
UniProt Gene Name
KLHL35
UniProt Entry Name
KLH35_HUMAN

Uniprot Description

KLHL35: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 11q13.4

Molecular Function: protein binding

Similar Products

Product Notes

The KLHL35 klhl35 (Catalog #AAA1267895) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgctggg tgcgccacga cgcgccggcc cgccgcggcc agctgcgacg cctgctggag cacgtgcgcc tgccgctact ggcgcccgct tacttcctgg agaaggtgga ggcggacgag ctgctgcagg cctgcggcga gtgccgcccg ctgctgctcg aggctcgcgc ctgcttcatc ctgggccgcg aggccggtgc gctgcggacc cggccgcgga gattcatgga cctagctgaa gtgatcgtgg tcatcggcgg ttgcgaccgc aaaggtctcc tgaagctgcc cttcgccgat gcctaccatc cagagagcca gcggtggacc ccactgccca gcctgcccgg ctacactcgc tcagaattcg ccgcctgtgc tctccgcaat gacgtctacg tctccggagg ccacatcaac agtcatgatg tgtggatgtt tagctcccat ctgcacacct ggatcaaggt agcctctctg cacaagggca ggtggaggca caagatggca gttgtgcagg ggcagctgtt cgcggtgggt ggcttcgacg gcctgaggcg cctgcacagc gtggagcgct acgacccctt ctccaacacc tgggcggccg ccgcgcccct cccggaggcc gtgagctcgg cggcggtggc gtcctgcgcg ggcaagctct tcgtgattgg gggcgccagg cagggcggcg tcaacacgga caaggtgcag tgctttgacc ccaaggagga ccggtggagc ctgcggtcac cagcaccctt ctcacagcgg tgtctcgagg ctgtctccct tgaggacacc atctatgtca tggggggtct catgagcaaa atcttcacct atgatccagg cacagatgtg tggggggagg cagctgtcct ccccagccct gtggaaagct gtggagtcac tgtgtgtgac gggaaggtcc acatccttgg cgggcgggat gatcgcggag aaagcaccga taaggtcttc acctttgacc ccagcagtgg gcaggtggag gtccagccat ccctgcagcg ctgcaccagc tcccacggct gtgtcaccat catccagagc ttgggcaggt ga. It is sometimes possible for the material contained within the vial of "KLHL35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.