Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HLA-F cdna clone

HLA-F cDNA Clone

Gene Names
HLA-F; HLAF; CDA12; HLA-5.4; HLA-CDA12
Synonyms
HLA-F; HLA-F cDNA Clone; HLA-F cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccccgaagcctcctcctgctgctctcaggggccctggccctgaccgatacttgggcaggctcccactccttgaggtatttcagcaccgctgtgtcgcggcccggccgcggggagccccgctacatcgccgtggagtacgtagacgacacgcaattcctgcggttcgacagcgacgccgcgattccgaggatggagccgcgggagccgtgggtggagcaagaggggccgcagtattgggagtggaccacagggtacgccaaggccaacgcacagactgaccgagtggccctgaggaacctgctccgccgctacaaccagagcgaggctgggtctcacaccctccagggaatgaatggctgcgacatggggcccgacggacgcctcctccgcgggtatcaccagcacgcgtacgacggcaaggattacatctccctgaacgaggacctgcgctcctggaccgcggcggacaccgtggctcagatcacccagcgcttctatgaggcagaggaatatgcagaggagttcaggacctacctggagggcgagtgcctggagttgctccgcagatacttggagaatgggaaggagacgctacagcgcgcagatcctccaaaggcacacgttgcccaccaccccatctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacgctgacctggcagcgggatggggaggaacagacccaggacacagagcttgtggagaccaggcctgcaggggatggaaccttccagaagtgggccgctgtggtggtgccttctggagaggaacagagatacacatgccatgtgcagcacgaggggctgccccagcccctcatcctgagatgggagcagtctccccagcccaccatccccatcgtgggcatcgttgctggccttgttgtccttggagctgtggtcactggagctgtggtcgctgctgtgatgtggaggaagaagagctcagatagaaacagagggagctactctcaggctgcagcctactcagtggtcagcggactcttgatgataacatggtggtcaagcttatttctcctgggggtgctcttccaaggatatttgggctgcctccggagtcacagtgtcttgggccgccggaaggtgggtgacatgtggatcttgttttttttgtggctgtggacatctttcaacactgccttcttggccttgcaaagccttcgctttggcttcggctttaggaggggcaggagcttccttcttcgttcttggcaccatcttatgaaaagggtccagattaagatttttgactga
Sequence Length
1329
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,438 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class I, F, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class I, F
NCBI Official Symbol
HLA-F
NCBI Official Synonym Symbols
HLAF; CDA12; HLA-5.4; HLA-CDA12
NCBI Protein Information
HLA class I histocompatibility antigen, alpha chain F
UniProt Protein Name
HLA class I histocompatibility antigen, alpha chain F
UniProt Gene Name
HLA-F
UniProt Synonym Gene Names
HLA-5.4; HLAF
UniProt Entry Name
HLAF_HUMAN

NCBI Description

This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]

Uniprot Description

HLA-F: Involved in the presentation of foreign antigens to the immune system. Belongs to the MHC class I family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cell surface; early endosome membrane; endoplasmic reticulum; Golgi membrane; membrane; phagocytic vesicle membrane; plasma membrane

Molecular Function: peptide antigen binding; receptor binding; TAP1 binding; TAP2 binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent; antigen processing and presentation of peptide antigen via MHC class I; regulation of immune response

Research Articles on HLA-F

Similar Products

Product Notes

The HLA-F hla-f (Catalog #AAA1267871) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcccc gaagcctcct cctgctgctc tcaggggccc tggccctgac cgatacttgg gcaggctccc actccttgag gtatttcagc accgctgtgt cgcggcccgg ccgcggggag ccccgctaca tcgccgtgga gtacgtagac gacacgcaat tcctgcggtt cgacagcgac gccgcgattc cgaggatgga gccgcgggag ccgtgggtgg agcaagaggg gccgcagtat tgggagtgga ccacagggta cgccaaggcc aacgcacaga ctgaccgagt ggccctgagg aacctgctcc gccgctacaa ccagagcgag gctgggtctc acaccctcca gggaatgaat ggctgcgaca tggggcccga cggacgcctc ctccgcgggt atcaccagca cgcgtacgac ggcaaggatt acatctccct gaacgaggac ctgcgctcct ggaccgcggc ggacaccgtg gctcagatca cccagcgctt ctatgaggca gaggaatatg cagaggagtt caggacctac ctggagggcg agtgcctgga gttgctccgc agatacttgg agaatgggaa ggagacgcta cagcgcgcag atcctccaaa ggcacacgtt gcccaccacc ccatctctga ccatgaggcc accctgaggt gctgggccct gggcttctac cctgcggaga tcacgctgac ctggcagcgg gatggggagg aacagaccca ggacacagag cttgtggaga ccaggcctgc aggggatgga accttccaga agtgggccgc tgtggtggtg ccttctggag aggaacagag atacacatgc catgtgcagc acgaggggct gccccagccc ctcatcctga gatgggagca gtctccccag cccaccatcc ccatcgtggg catcgttgct ggccttgttg tccttggagc tgtggtcact ggagctgtgg tcgctgctgt gatgtggagg aagaagagct cagatagaaa cagagggagc tactctcagg ctgcagccta ctcagtggtc agcggactct tgatgataac atggtggtca agcttatttc tcctgggggt gctcttccaa ggatatttgg gctgcctccg gagtcacagt gtcttgggcc gccggaaggt gggtgacatg tggatcttgt tttttttgtg gctgtggaca tctttcaaca ctgccttctt ggccttgcaa agccttcgct ttggcttcgg ctttaggagg ggcaggagct tccttcttcg ttcttggcac catcttatga aaagggtcca gattaagatt tttgactga. It is sometimes possible for the material contained within the vial of "HLA-F, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.