Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACAD8 cdna clone

ACAD8 cDNA Clone

Gene Names
ACAD8; ARC42; ACAD-8
Synonyms
ACAD8; ACAD8 cDNA Clone; ACAD8 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtggagcggctgccggcgtttcggggcgcgcctcggctgcctgcccggcggtctccgggtcctcgtccagaccggccaccggagcttgacctcctgcatcgacccttccatgggacttaatgaagagcagaaagaatttcaaaaagtggcctttgactttgctgcccgagagatggctccaaatatggcagagtgggaccagaaggagctgttcccagtggatgtgatgcggaaggcagcccagctaggcttcggaggggtctacatacaaacagatgtgggcgggtctgggctgtcacgtcttgatacctctgtcatttttgaagccttggctacaggctgcaccagcaccacagcctatataagcatccacaacatgtgtgcctggatgattgatagcttcggaaatgaggaacagaggcacaaattttgcccaccgctctgtaccatggagaagtttgcttcctactgcctcactgaaccaggaagtgggagtgatgctgcctctcttctgacctccgctaagaaacagggagatcattacatcctcaatggctccaaggccttcatcagtggtgctggtgagtcagacatctatgtggtcatgtgccgaacaggaggactaggccccaagggcatctcatgcatagttgttgagaaggggacccctggcctcagctttggcaagaaggagaaaaaggtggggtggaactcccagccaacacgagctgtgatcttcgaagactgtgctgtccctgtggccaacagaattgggagcgaggggcagggcttcctcattgccgtgagaggactgaacggagggaggatcaatattgcttcctgctccctgggggctgcccacgcctctgtcatcctcacccgagaccacctcaatgtccggaagcagtttggagagcctctggccagtaaccagtacttgcaattcacactggctgatatggcaacaaggctggtggccgcgcggctgatggtccgcaatgcagcagtggctctgcaggaggagaggaaggatgcagtggccttgtgctccatggccaagctctttgctacagatgaatgctttgccatctgcaaccaggccttgcagatgcacgggggctacggctacctgaaggattacgctgttcagcagtacgtgcgggactccagggtccaccagattctagaaggtagcaatgaagtgatgaggatactgatctctagaagcctgcttcaggagtag
Sequence Length
1248
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,359 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase family, member 8, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase family member 8
NCBI Official Symbol
ACAD8
NCBI Official Synonym Symbols
ARC42; ACAD-8
NCBI Protein Information
isobutyryl-CoA dehydrogenase, mitochondrial
UniProt Protein Name
Isobutyryl-CoA dehydrogenase, mitochondrial
UniProt Gene Name
ACAD8
UniProt Synonym Gene Names
ARC42; IBD; ARC42; ACAD-8
UniProt Entry Name
ACAD8_HUMAN

NCBI Description

This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]

Uniprot Description

ACAD8: Has very high activity toward isobutyryl-CoA. Is an isobutyryl-CoA dehydrogenase that functions in valine catabolism. Plays a role in transcriptional coactivation within the ARC complex. Defects in ACAD8 are the cause of isobutyryl-CoA dehydrogenase deficiency (IBDD). The symptoms of IBDD generally appear until late in infancy or in childhood and can include poor feeding and growth (failure to thrive), a weakened and enlarged heart (dilated cardiomyopathy), seizures, and low numbers of red blood cells (anemia). Belongs to the acyl-CoA dehydrogenase family.

Protein type: Amino Acid Metabolism - valine, leucine and isoleucine degradation; Oxidoreductase; Mitochondrial; EC 1.3.99.-

Chromosomal Location of Human Ortholog: 11q25

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding

Biological Process: branched chain family amino acid catabolic process; fatty acid beta-oxidation using acyl-CoA dehydrogenase; lipid homeostasis; lipid metabolic process

Disease: Isobutyryl-coa Dehydrogenase Deficiency

Research Articles on ACAD8

Similar Products

Product Notes

The ACAD8 acad8 (Catalog #AAA1267863) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtgga gcggctgccg gcgtttcggg gcgcgcctcg gctgcctgcc cggcggtctc cgggtcctcg tccagaccgg ccaccggagc ttgacctcct gcatcgaccc ttccatggga cttaatgaag agcagaaaga atttcaaaaa gtggcctttg actttgctgc ccgagagatg gctccaaata tggcagagtg ggaccagaag gagctgttcc cagtggatgt gatgcggaag gcagcccagc taggcttcgg aggggtctac atacaaacag atgtgggcgg gtctgggctg tcacgtcttg atacctctgt catttttgaa gccttggcta caggctgcac cagcaccaca gcctatataa gcatccacaa catgtgtgcc tggatgattg atagcttcgg aaatgaggaa cagaggcaca aattttgccc accgctctgt accatggaga agtttgcttc ctactgcctc actgaaccag gaagtgggag tgatgctgcc tctcttctga cctccgctaa gaaacaggga gatcattaca tcctcaatgg ctccaaggcc ttcatcagtg gtgctggtga gtcagacatc tatgtggtca tgtgccgaac aggaggacta ggccccaagg gcatctcatg catagttgtt gagaagggga cccctggcct cagctttggc aagaaggaga aaaaggtggg gtggaactcc cagccaacac gagctgtgat cttcgaagac tgtgctgtcc ctgtggccaa cagaattggg agcgaggggc agggcttcct cattgccgtg agaggactga acggagggag gatcaatatt gcttcctgct ccctgggggc tgcccacgcc tctgtcatcc tcacccgaga ccacctcaat gtccggaagc agtttggaga gcctctggcc agtaaccagt acttgcaatt cacactggct gatatggcaa caaggctggt ggccgcgcgg ctgatggtcc gcaatgcagc agtggctctg caggaggaga ggaaggatgc agtggccttg tgctccatgg ccaagctctt tgctacagat gaatgctttg ccatctgcaa ccaggccttg cagatgcacg ggggctacgg ctacctgaag gattacgctg ttcagcagta cgtgcgggac tccagggtcc accagattct agaaggtagc aatgaagtga tgaggatact gatctctaga agcctgcttc aggagtag. It is sometimes possible for the material contained within the vial of "ACAD8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.