Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL33 cdna clone

IL33 cDNA Clone

Gene Names
IL33; DVS27; IL1F11; NF-HEV; NFEHEV; C9orf26
Synonyms
IL33; IL33 cDNA Clone; IL33 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcctaaaatgaagtattcaaccaacaaaatttccacagcaaagtggaagaacacagcaagcaaagccttgtgtttcaagctgggaaaatcccaacagaaggccaaagaagtttgccccatgtactttatgaagctccgctctggccttatgataaaaaaggaggcctgttactttaggagagaaaccaccaaaaggccttcactgaaaacaggtagaaagcacaaaagacatctggtactcgctgcctgtcaacagcagtctactgtggagtgctttgcctttggtatatcaggggtccagaaatatactagagcacttcatgattcaagtatcacaggaatttcacctattacagagtatcttgcttctctaagcacatacaatgatcaatccattacttttgctttggaggatgaaagttatgagatatatgttgaagacttgaaaaaagatgaaaagaaagataaggtgttactgagttactatgagtctcaacacccctcaaatgaatcaggtgacggtgttgatggtaagatgttaatggtaaccctgagtcctacaaaagacttctggttgcatgccaacaacaaggaacactctgtggagctccataagtgtgaaaaaccactgccagaccaggccttctttgtccttcataatatgcactccaactgtgtttcatttgaatgcaagactgatcctggagtgtttataggtgtaaaggataatcatcttgctctgattaaagtagactcttctgagaatttgtgtactgaaaatatcttgtttaagctctctgaaacttag
Sequence Length
813
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,250 Da
NCBI Official Full Name
Homo sapiens interleukin 33, mRNA
NCBI Official Synonym Full Names
interleukin 33
NCBI Official Symbol
IL33
NCBI Official Synonym Symbols
DVS27; IL1F11; NF-HEV; NFEHEV; C9orf26
NCBI Protein Information
interleukin-33
UniProt Protein Name
Interleukin-33
Protein Family
UniProt Gene Name
IL33
UniProt Synonym Gene Names
C9orf26; IL1F11; NFHEV; IL-33; IL-1F11; NF-HEV
UniProt Entry Name
IL33_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]

Uniprot Description

IL33: Cytokine that binds to and signals through IL1RL1/ST2 and its stimulation recruits MYD88, IRAK1, IRAK4, and TRAF6, followed by phosphorylation of MAPK3/ERK1 and/or MAPK1/ERK2, MAPK14, and MAPK8. Induces T-helper type 2-associated cytokines. Belongs to the IL-1 family. Highly divergent. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytokine

Chromosomal Location of Human Ortholog: 9p24.1

Cellular Component: extracellular region

Molecular Function: cytokine activity; protein binding

Biological Process: positive regulation of inflammatory response; positive regulation of macrophage activation; positive regulation of transcription from RNA polymerase II promoter; T-helper 2 type immune response

Research Articles on IL33

Similar Products

Product Notes

The IL33 il33 (Catalog #AAA1267843) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccta aaatgaagta ttcaaccaac aaaatttcca cagcaaagtg gaagaacaca gcaagcaaag ccttgtgttt caagctggga aaatcccaac agaaggccaa agaagtttgc cccatgtact ttatgaagct ccgctctggc cttatgataa aaaaggaggc ctgttacttt aggagagaaa ccaccaaaag gccttcactg aaaacaggta gaaagcacaa aagacatctg gtactcgctg cctgtcaaca gcagtctact gtggagtgct ttgcctttgg tatatcaggg gtccagaaat atactagagc acttcatgat tcaagtatca caggaatttc acctattaca gagtatcttg cttctctaag cacatacaat gatcaatcca ttacttttgc tttggaggat gaaagttatg agatatatgt tgaagacttg aaaaaagatg aaaagaaaga taaggtgtta ctgagttact atgagtctca acacccctca aatgaatcag gtgacggtgt tgatggtaag atgttaatgg taaccctgag tcctacaaaa gacttctggt tgcatgccaa caacaaggaa cactctgtgg agctccataa gtgtgaaaaa ccactgccag accaggcctt ctttgtcctt cataatatgc actccaactg tgtttcattt gaatgcaaga ctgatcctgg agtgtttata ggtgtaaagg ataatcatct tgctctgatt aaagtagact cttctgagaa tttgtgtact gaaaatatct tgtttaagct ctctgaaact tag. It is sometimes possible for the material contained within the vial of "IL33, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.