Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGA5 cdna clone

ITGA5 cDNA Clone

Gene Names
ITGA5; FNRA; CD49e; VLA-5; VLA5A
Synonyms
ITGA5; ITGA5 cDNA Clone; ITGA5 cdna clone
Ordering
For Research Use Only!
Sequence
atggggagccggacgccagagtcccctctccacgccgtgcagctgcgctggggcccccggcgccgacccccgctgctgccgctgctgttgctgctgctgccgccgccacccagggtcgggggcttcaacttagacgcggaggccccagcagtactctcggggcccccgggctccttcttcggattctcagtggagttttaccggccgggaacagacggggtcagtgtgctggtgggagcacccaaggctaataccagccagccaggagtgctgcagggtggtgctgtctacctctgtccttggggtgccagccccacacagtgcacccccattgaatttgacagcaaaggctctcggctcctggagtcctcactgtccagctcagagggagaggagcctgtggagtacaagtccttgcagtggttcggggcaacagttcgagcccatggctcctccatcttggcatgcgctccactgtacagctggcgcacagagaaggagccactgagcgaccccgtgggcacctgctacctctccacagataacttcacccgaattctggagtatgcaccctgccgctcagatttcagctgggcagcaggacagggttactgccaaggaggcttcagtgccgagttcaccaagactggccgtgtggttttaggtggaccaggaagctatttctggcaaggccagatcctgtctgccactcaggagcagattgcagaatcttattaccccgagtacctgatcaacctggttcaggggcagctgcagactcgccaggccagttccatctatgatgacagctacctaggatactctgtggctgttggtgaattcagtggtgatgacacagaagactttgttgctggtgtgcccaaagggaacctcacttacggctatgtcaccatccttaatggctcagacattcgatccctctacaacttctcaggggaacagatggcctcctactttggctatgcagtggccgccacagacgtcaatggggacgggctggatgacttgctggtgggggcacccctgctcatggatcggacccctgacgggcggcctcaggaggtgggcagggtctacgtctacctgcagcacccagccggcatagagcccacgcccacccttaccctcactggccatgatgagtttggccgatttggcagctccttgacccccctgggggacctggaccaggatggctacaatgatgtggccatcggggctccctttggtggggagacccagcagggagtagtgtttgtatttcctgggggcccaggagggctgggctctaagccttcccaggttctgcagcccctgtgggcagccagccacaccccagacttctttggctctgcccttcgaggaggccgagacctggatggcaatggatatcctgatctgattgtggggtcctttggtgtggacaaggctgtggtatacaggggccgccccatcgtgtccgctagtgcctccctcaccatcttccccgccatgttcaacccagaggagcggagctgcagcttagaggggaaccctgtggcctgcatcaaccttagcttctgcctcaatgcttctggaaaacacgttgctgactccattggtttcacagtggaacttcagctggactggcagaagcagaagggaggggtacggcgggcactgttcctggcctccaggcaggcaaccctgacccagaccctgctcatccagaatggggctcgagaggattgcagagagatgaagatctacctcaggaacgagtcagaatttcgagacaaactctcgccgattcacatcgctctcaacttctccttggacccccaagccccagtggacagccacggcctcaggccagccctacattatcagagcaagagccggatagaggacaaggctcagatcttgctggactgtggagaagacaacatctgtgtgcctgacctgcagctggaagtgtttggggagcagaaccatgtgtacctgggtgacaagaatgccctgaacctcactttccatgcccagaatgtgggtgagggtggcgcctatgaggctgagcttcgggtcaccgcccctccagaggctgagtactcaggactcgtcagacacccagggaacttctccagcctgagctgtgactactttgccgtgaaccagagccgcctgctggtgtgtgacctgggcaaccccatgaaggcaggagccagtctgtggggtggccttcggtttacagtccctcatctccgggacactaagaaaaccatccagtttgacttccagatcctcagcaagaatctcaacaactcgcaaagcgacgtggtttcctttcggctctccgtggaggctcaggcccaggtcaccctgaacggtgtctccaagcctgaggcagtgctattcccagtaagcgactggcatccccgagaccagcctcagaaggaggaggacctgggacctgctgtccaccatgtctatgagctcatcaaccaaggccccagctccattagccagggtgtgctggaactcagctgtccccaggctctggaaggtcagcagctcctatatgtgaccagagttacgggactcaactgcaccaccaatcaccccattaacccaaagggcctggagttggatcccgagggttccctgcaccaccagcaaaaacgggaagctccaagccgcagctctgcttcctcgggacctcagatcctgaaatgcccggaggctgagtgtttcaggctgcgctgtgagctcgggcccctgcaccaacaagagagccaaagtctgcagttgcatttccgagtctgggccaagactttcttgcagcgggagcaccagccatttagcctgcagtgtgaggctgtgtacaaagccctgaagatgccctaccgaatcctgcctcggcagctgccccaaaaagagcgtcaggtggccacagctgtgcaatggaccaaggcagaaggcagctatggcgtcccactgtggatcatcatcctagccatcctgtttggcctcctgctcctaggtctactcatctacatcctctacaagcttggattcttcaaacgctccctcccatatggcaccgccatggaaaaagctcagctcaagcctccagccacctctgatgcctga
Sequence Length
3150
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
114,536 Da
NCBI Official Full Name
Homo sapiens integrin, alpha 5 (fibronectin receptor, alpha polypeptide), mRNA
NCBI Official Synonym Full Names
integrin subunit alpha 5
NCBI Official Symbol
ITGA5
NCBI Official Synonym Symbols
FNRA; CD49e; VLA-5; VLA5A
NCBI Protein Information
integrin alpha-5
UniProt Protein Name
Integrin alpha-5
Protein Family
UniProt Gene Name
ITGA5
UniProt Synonym Gene Names
FNRA
UniProt Entry Name
ITA5_HUMAN

NCBI Description

The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha subunit and a beta subunit that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 5 subunit. This subunit associates with the beta 1 subunit to form a fibronectin receptor. This integrin may promote tumor invasion, and higher expression of this gene may be correlated with shorter survival time in lung cancer patients. Note that the integrin alpha 5 and integrin alpha V subunits are encoded by distinct genes. [provided by RefSeq, Oct 2015]

Uniprot Description

ITGA5: Integrin alpha-5/beta-1 is a receptor for fibronectin and fibrinogen. It recognizes the sequence R-G-D in its ligands. In case of HIV-1 infection, the interaction with extracellular viral Tat protein seems to enhance angiogenesis in Kaposi's sarcoma lesions. Heterodimer of an alpha and a beta subunit. The alpha subunit is composed of an heavy and a light chain linked by a disulfide bond. Alpha-5 associates with beta-1. Interacts with HPS5 and NISCH. Interacts with RAB21 and COMP. Interacts with HIV- 1 Tat. Belongs to the integrin alpha chain family.

Protein type: Cell adhesion; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 12q11-q13

Cellular Component: cell surface; focal adhesion; intercellular junction; plasma membrane; ruffle

Molecular Function: platelet-derived growth factor receptor binding; protein binding; vascular endothelial growth factor receptor 2 binding

Biological Process: angiogenesis; cell adhesion; cell-substrate adhesion; extracellular matrix organization and biogenesis; heterotypic cell-cell adhesion; leukocyte migration; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of vascular endothelial growth factor receptor signaling pathway; wound healing, spreading of epidermal cells

Research Articles on ITGA5

Similar Products

Product Notes

The ITGA5 itga5 (Catalog #AAA1267766) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagcc ggacgccaga gtcccctctc cacgccgtgc agctgcgctg gggcccccgg cgccgacccc cgctgctgcc gctgctgttg ctgctgctgc cgccgccacc cagggtcggg ggcttcaact tagacgcgga ggccccagca gtactctcgg ggcccccggg ctccttcttc ggattctcag tggagtttta ccggccggga acagacgggg tcagtgtgct ggtgggagca cccaaggcta ataccagcca gccaggagtg ctgcagggtg gtgctgtcta cctctgtcct tggggtgcca gccccacaca gtgcaccccc attgaatttg acagcaaagg ctctcggctc ctggagtcct cactgtccag ctcagaggga gaggagcctg tggagtacaa gtccttgcag tggttcgggg caacagttcg agcccatggc tcctccatct tggcatgcgc tccactgtac agctggcgca cagagaagga gccactgagc gaccccgtgg gcacctgcta cctctccaca gataacttca cccgaattct ggagtatgca ccctgccgct cagatttcag ctgggcagca ggacagggtt actgccaagg aggcttcagt gccgagttca ccaagactgg ccgtgtggtt ttaggtggac caggaagcta tttctggcaa ggccagatcc tgtctgccac tcaggagcag attgcagaat cttattaccc cgagtacctg atcaacctgg ttcaggggca gctgcagact cgccaggcca gttccatcta tgatgacagc tacctaggat actctgtggc tgttggtgaa ttcagtggtg atgacacaga agactttgtt gctggtgtgc ccaaagggaa cctcacttac ggctatgtca ccatccttaa tggctcagac attcgatccc tctacaactt ctcaggggaa cagatggcct cctactttgg ctatgcagtg gccgccacag acgtcaatgg ggacgggctg gatgacttgc tggtgggggc acccctgctc atggatcgga cccctgacgg gcggcctcag gaggtgggca gggtctacgt ctacctgcag cacccagccg gcatagagcc cacgcccacc cttaccctca ctggccatga tgagtttggc cgatttggca gctccttgac ccccctgggg gacctggacc aggatggcta caatgatgtg gccatcgggg ctccctttgg tggggagacc cagcagggag tagtgtttgt atttcctggg ggcccaggag ggctgggctc taagccttcc caggttctgc agcccctgtg ggcagccagc cacaccccag acttctttgg ctctgccctt cgaggaggcc gagacctgga tggcaatgga tatcctgatc tgattgtggg gtcctttggt gtggacaagg ctgtggtata caggggccgc cccatcgtgt ccgctagtgc ctccctcacc atcttccccg ccatgttcaa cccagaggag cggagctgca gcttagaggg gaaccctgtg gcctgcatca accttagctt ctgcctcaat gcttctggaa aacacgttgc tgactccatt ggtttcacag tggaacttca gctggactgg cagaagcaga agggaggggt acggcgggca ctgttcctgg cctccaggca ggcaaccctg acccagaccc tgctcatcca gaatggggct cgagaggatt gcagagagat gaagatctac ctcaggaacg agtcagaatt tcgagacaaa ctctcgccga ttcacatcgc tctcaacttc tccttggacc cccaagcccc agtggacagc cacggcctca ggccagccct acattatcag agcaagagcc ggatagagga caaggctcag atcttgctgg actgtggaga agacaacatc tgtgtgcctg acctgcagct ggaagtgttt ggggagcaga accatgtgta cctgggtgac aagaatgccc tgaacctcac tttccatgcc cagaatgtgg gtgagggtgg cgcctatgag gctgagcttc gggtcaccgc ccctccagag gctgagtact caggactcgt cagacaccca gggaacttct ccagcctgag ctgtgactac tttgccgtga accagagccg cctgctggtg tgtgacctgg gcaaccccat gaaggcagga gccagtctgt ggggtggcct tcggtttaca gtccctcatc tccgggacac taagaaaacc atccagtttg acttccagat cctcagcaag aatctcaaca actcgcaaag cgacgtggtt tcctttcggc tctccgtgga ggctcaggcc caggtcaccc tgaacggtgt ctccaagcct gaggcagtgc tattcccagt aagcgactgg catccccgag accagcctca gaaggaggag gacctgggac ctgctgtcca ccatgtctat gagctcatca accaaggccc cagctccatt agccagggtg tgctggaact cagctgtccc caggctctgg aaggtcagca gctcctatat gtgaccagag ttacgggact caactgcacc accaatcacc ccattaaccc aaagggcctg gagttggatc ccgagggttc cctgcaccac cagcaaaaac gggaagctcc aagccgcagc tctgcttcct cgggacctca gatcctgaaa tgcccggagg ctgagtgttt caggctgcgc tgtgagctcg ggcccctgca ccaacaagag agccaaagtc tgcagttgca tttccgagtc tgggccaaga ctttcttgca gcgggagcac cagccattta gcctgcagtg tgaggctgtg tacaaagccc tgaagatgcc ctaccgaatc ctgcctcggc agctgcccca aaaagagcgt caggtggcca cagctgtgca atggaccaag gcagaaggca gctatggcgt cccactgtgg atcatcatcc tagccatcct gtttggcctc ctgctcctag gtctactcat ctacatcctc tacaagcttg gattcttcaa acgctccctc ccatatggca ccgccatgga aaaagctcag ctcaagcctc cagccacctc tgatgcctga. It is sometimes possible for the material contained within the vial of "ITGA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.