Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABCD3 cdna clone

ABCD3 cDNA Clone

Gene Names
ABCD3; ZWS2; ABC43; CBAS5; PMP70; PXMP1
Synonyms
ABCD3; ABCD3 cDNA Clone; ABCD3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccttcagcaagtacttgacggcgcgaaactcctcgctggctggtgccgcgttcctgctgctctgcctgctccacaagcggcgccgcgccctcggcctgcacggtaagaaaagtggaaaaccaccattacagaacaatgagaaagaggggaaaaaggagcgagctgtggtggacaaggtgtttttctcaaggctcatacagattctgaaaatcatggtccctagaacattttgtaaagagacaggttacttggtacttattgctgttatgctggtgtctcgaacatattgtgatgtttggatgattcaaaatgggacactaattgaaagtggtatcattggtcgtagcaggaaagatttcaagagatacttactcaacttcatcgctgccatgcctcttatctctctggttaataacttcttgaagtatgggttaaatgagcttaaactgtgcttccgagtaaggctcactaaatacctctatgaggagtatcttcaagctttcacatattataaaatggggaatctggacaacagaatagctaatccagaccagctgcttacacaagatgtagaaaaattttgtaacagtgtagtcgatctgtattcaaatcttagtaagccatttttagacatagttttgtatatctttaagttaacgagtgcaattggagctcagggcccagcgagcatgatggcctacttggttgtttctgggctattcctaactcgacttcgaagacccattggtaagatgacaataactgagcaaaagtatgaaggagaatatagatatgttaattctcggctcatcacaaacagttttactgctcggattacagaattaatgcaagtactgaaggatttaaatcatggcaaatatgagcgcacaatggtctcacaacaggaaaagggtattgaaggagtacaagtcattcccttgatacctggtgctggagaaatcattattgcagataacattataaagtttgatcatgttcctttagcaacgccaaatggagatgttttgatccgagaccttaattttgaagttcgatctggggctaatgttctaatttgtggtccaaatggctgcggaaagagttcacttttccgtgttcttggtgaattatggcctctttttggaggacgtctaactaaacctgaaagaggaaaattattttatgttcctcagagaccttacatgacccttggaacacttcgagatcaagtgatatatccagatggacgagaagatcagaaaaggaagggaatttctgacctagtactgaaggaatacttagacaatgtccagttgggtcatatccttgaacgtgaaggaggctgggacagtgttcaggattggatggacgtactcagtggtggagaaaagcaaagaatggcgatggcaagattattttatcataaaccccagtttgccattttggatgaatgcacaagtgcagttagtgtcgacgtggaaggctacatttatagtcattgtcgaaaggttggcatcactctcttcactgtgtctcataggaaatctctttggaaacatcatgagtactacctgcatatggatggcagaggcaactatgaattcaaacagataacagaagatacagttgagtttggctcttag
Sequence Length
1650
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,121 Da
NCBI Official Full Name
Homo sapiens ATP-binding cassette, sub-family D (ALD), member 3, mRNA
NCBI Official Synonym Full Names
ATP binding cassette subfamily D member 3
NCBI Official Symbol
ABCD3
NCBI Official Synonym Symbols
ZWS2; ABC43; CBAS5; PMP70; PXMP1
NCBI Protein Information
ATP-binding cassette sub-family D member 3
UniProt Protein Name
ATP-binding cassette sub-family D member 3
Protein Family
UniProt Gene Name
ABCD3
UniProt Synonym Gene Names
PMP70; PXMP1; PMP70
UniProt Entry Name
ABCD3_HUMAN

NCBI Description

The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

ABCD3: a member of the superfamily of ATP-binding cassette (ABC) transporters. Likely plays an important role in peroxisome biogenesis. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. Defects in ABCD3 may be the cause of Zellweger syndrome-2 (ZWS-2), an autosomal recessive disorder due to defective import mechanisms for peroxisomal matrix enzymes.

Protein type: Transporter; Membrane protein, multi-pass; Transporter, ABC family; Membrane protein, integral; Mitochondrial

Chromosomal Location of Human Ortholog: 1p21.3

Cellular Component: cytosol; intracellular membrane-bound organelle; membrane; peroxisomal matrix; peroxisomal membrane; peroxisome

Molecular Function: ATP binding; ATPase activity; long-chain fatty acid transporter activity; protein binding; protein homodimerization activity

Biological Process: fatty acid beta-oxidation; fatty acid biosynthetic process; peroxisome organization and biogenesis; transmembrane transport; very-long-chain fatty acid catabolic process

Disease: Bile Acid Synthesis Defect, Congenital, 5

Research Articles on ABCD3

Similar Products

Product Notes

The ABCD3 abcd3 (Catalog #AAA1267736) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcct tcagcaagta cttgacggcg cgaaactcct cgctggctgg tgccgcgttc ctgctgctct gcctgctcca caagcggcgc cgcgccctcg gcctgcacgg taagaaaagt ggaaaaccac cattacagaa caatgagaaa gaggggaaaa aggagcgagc tgtggtggac aaggtgtttt tctcaaggct catacagatt ctgaaaatca tggtccctag aacattttgt aaagagacag gttacttggt acttattgct gttatgctgg tgtctcgaac atattgtgat gtttggatga ttcaaaatgg gacactaatt gaaagtggta tcattggtcg tagcaggaaa gatttcaaga gatacttact caacttcatc gctgccatgc ctcttatctc tctggttaat aacttcttga agtatgggtt aaatgagctt aaactgtgct tccgagtaag gctcactaaa tacctctatg aggagtatct tcaagctttc acatattata aaatggggaa tctggacaac agaatagcta atccagacca gctgcttaca caagatgtag aaaaattttg taacagtgta gtcgatctgt attcaaatct tagtaagcca tttttagaca tagttttgta tatctttaag ttaacgagtg caattggagc tcagggccca gcgagcatga tggcctactt ggttgtttct gggctattcc taactcgact tcgaagaccc attggtaaga tgacaataac tgagcaaaag tatgaaggag aatatagata tgttaattct cggctcatca caaacagttt tactgctcgg attacagaat taatgcaagt actgaaggat ttaaatcatg gcaaatatga gcgcacaatg gtctcacaac aggaaaaggg tattgaagga gtacaagtca ttcccttgat acctggtgct ggagaaatca ttattgcaga taacattata aagtttgatc atgttccttt agcaacgcca aatggagatg ttttgatccg agaccttaat tttgaagttc gatctggggc taatgttcta atttgtggtc caaatggctg cggaaagagt tcacttttcc gtgttcttgg tgaattatgg cctctttttg gaggacgtct aactaaacct gaaagaggaa aattatttta tgttcctcag agaccttaca tgacccttgg aacacttcga gatcaagtga tatatccaga tggacgagaa gatcagaaaa ggaagggaat ttctgaccta gtactgaagg aatacttaga caatgtccag ttgggtcata tccttgaacg tgaaggaggc tgggacagtg ttcaggattg gatggacgta ctcagtggtg gagaaaagca aagaatggcg atggcaagat tattttatca taaaccccag tttgccattt tggatgaatg cacaagtgca gttagtgtcg acgtggaagg ctacatttat agtcattgtc gaaaggttgg catcactctc ttcactgtgt ctcataggaa atctctttgg aaacatcatg agtactacct gcatatggat ggcagaggca actatgaatt caaacagata acagaagata cagttgagtt tggctcttag. It is sometimes possible for the material contained within the vial of "ABCD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.