Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRP12 cdna clone

LRP12 cDNA Clone

Gene Names
LRP12; ST7
Synonyms
LRP12; LRP12 cDNA Clone; LRP12 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagatattctactatgcattaaatcttgaactttataaaacatgtacaaaaattgtacaagataagttccacctggtaatgtctttccctaatacagggttgcgcttgcattggaccctagggatttgcactaaaattatatcaaggtctcagatgagcttagtgcacaagcactatcactttaaatactattatttgctaccacagcaactatatatttccatagcttttggctgggggcgggggacatttttattacaacttgaaattgctttgctggtttcatatttatttgttgtatttaaaaaatacattgttgtaagagtgattttttcaatatattttattcctgggggggatcatgctacactctcaaaagaaaattaa
Sequence Length
390
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
93,123 Da
NCBI Official Full Name
Homo sapiens low density lipoprotein-related protein 12, mRNA
NCBI Official Synonym Full Names
LDL receptor related protein 12
NCBI Official Symbol
LRP12
NCBI Official Synonym Symbols
ST7
NCBI Protein Information
low-density lipoprotein receptor-related protein 12
UniProt Protein Name
Low-density lipoprotein receptor-related protein 12
UniProt Gene Name
LRP12
UniProt Synonym Gene Names
ST7; LRP-12
UniProt Entry Name
LRP12_HUMAN

NCBI Description

This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]

Uniprot Description

LRP12: Probable receptor, which may be involved in the internalization of lipophilic molecules and/or signal transduction. May act as a tumor suppressor. Belongs to the LDLR family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 8q22.2

Cellular Component: integral to plasma membrane

Molecular Function: protein binding

Research Articles on LRP12

Similar Products

Product Notes

The LRP12 lrp12 (Catalog #AAA1267697) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatat tctactatgc attaaatctt gaactttata aaacatgtac aaaaattgta caagataagt tccacctggt aatgtctttc cctaatacag ggttgcgctt gcattggacc ctagggattt gcactaaaat tatatcaagg tctcagatga gcttagtgca caagcactat cactttaaat actattattt gctaccacag caactatata tttccatagc ttttggctgg gggcggggga catttttatt acaacttgaa attgctttgc tggtttcata tttatttgtt gtatttaaaa aatacattgt tgtaagagtg attttttcaa tatattttat tcctgggggg gatcatgcta cactctcaaa agaaaattaa. It is sometimes possible for the material contained within the vial of "LRP12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.