Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGB2 cdna clone

ITGB2 cDNA Clone

Gene Names
ITGB2; LAD; CD18; MF17; MFI7; LCAMB; LFA-1; MAC-1
Synonyms
ITGB2; ITGB2 cDNA Clone; ITGB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgggcctgcgccccccacttctcgccctggtggggctgctctccctcgggtgcgtcctctctcaggagtgcacgaagttcaaggtcagcagctgccgggaatgcatcgagtcggggcccggctgcacctggtgccagaagctgaacttcacagggccgggggatcctgactccattcgctgcgacacccggccacagctgctcatgaggggctgtgcggctgacgacatcatggaccccacaagcctcgctgaaacccaggaagaccacaatgggggccagaagcagctgtccccacaaaaagtgacgctttacctgcgaccaggccaggcagcagcgttcaacgtgaccttccggcgggccaagggctaccccatcgacctgtactatctgatggacctctcctactccatgcttgatgacctcaggaatgtcaagaagctaggtggcgacctgctccgggccctcaacgagatcaccgagtccggccgcattggcttcgggtccttcgtggacaagaccgtgctgccgttcgtgaacacgcaccctgataagctgcgaaacccatgccccaacaaggagaaagagtgccagcccccgtttgccttcaggcacgtgctgaagctgaccaacaactccaaccagtttcagaccgaggtcgggaagcagctgatttccggaaacctggatgcacccgagggtgggctggacgccatgatgcaggtcgccgcctgcccggaggaaatcggctggcgcaacgtcacgcggctgctggtgtttgccactgatgacggcttccatttcgcgggcgacgggaagctgggcgccatcctgacccccaacgacggccgctgtcacctggaggacaacttgtacaagaggagcaacgaattcgactacccatcggtgggccagctggcgcacaagctggctgaaaacaacatccagcccatcttcgcggtgaccagtaggatggtgaagacctacgagaaactcaccgagatcatccccaagtcagccgtgggggagctgtctgaggactccagcaatgtggtccatctcattaagaatgcttacaataaactctcctccagggtattcctggatcacaacgccctccccgacaccctgaaagtcacctacgactccttctgcagcaatggagtgacgcacaggaaccagcccagaggtgactgtgatggcgtgcagatcaatgtcccgatcaccttccaggtgaaggtcacggccacagagtgcatccaggagcagtcgtttgtcatccgggcgctgggcttcacggacatagtgaccgtgcaggtccttccccagtgtgagtgccggtgccgggaccagagcagagaccgcagcctctgccatggcaagggcttcttggagtgcggcatctgcaggtgtgacactggctacattgggaaaaactgtgagtgccagacacagggccggagcagccaggagctggaaggaagctgccggaaggacaacaactccatcatctgctcagggctgggggactgtgtctgcgggcagtgcctgtgccacaccagcgacgtccccggcaagctgatatacgggcagtactgcgagtgtgacaccatcaactgtgagcgctacaacggccaggtctgcggcggcccggggagggggctctgcttctgcgggaagtgccgctgccacccgggctttgagggctcagcgtgccagtgcgagaggaccactgagggctgcctgaacccgcggcgtgttgagtgtagtggtcgtggccggtgccgctgcaacgtatgcgagtgccattcaggctaccagctgcctctgtgccaggagtgccccggctgcccctcaccctgtggcaagtacatctcctgcgccgagtgcctgaagttcgaaaagggcccctttgggaagaactgcagcgcggcgtgtccgggcctgcagctgtcgaacaaccccgtgaagggcaggacctgcaaggagagggactcagagggctgctgggtggcctacacgctggagcagcaggacgggatggaccgctacctcatctatgtggatgagagccgagagtgtgtggcaggccccaacatcgccgccatcgtcgggggcaccgtggcaggcatcgtgctgatcggcattctcctgctggtcatctggaaggctctgatccacctgagcgacctccgggagtacaggcgctttgagaaggagaagctcaagtcccagtggaacaatgataatccccttttcaagagcgccaccacgacggtcatgaaccccaagtttgctgagagttag
Sequence Length
2310
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,782 Da
NCBI Official Full Name
Homo sapiens integrin, beta 2 (complement component 3 receptor 3 and 4 subunit), mRNA
NCBI Official Synonym Full Names
integrin subunit beta 2
NCBI Official Symbol
ITGB2
NCBI Official Synonym Symbols
LAD; CD18; MF17; MFI7; LCAMB; LFA-1; MAC-1
NCBI Protein Information
integrin beta-2
UniProt Protein Name
Integrin beta-2
Protein Family
UniProt Gene Name
ITGB2
UniProt Synonym Gene Names
CD18; MFI7
UniProt Entry Name
ITB2_HUMAN

NCBI Description

This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Uniprot Description

ITGB2: the integrin beta 2 subunit. Can combine with multiple partners resulting in different integrins. For example, beta 2 combines with the alpha L chain to form the integrin LFA-1, and combines with the alpha M chain to form the integrin Mac-1. Participates in cell adhesion as well as cell-surface mediated signaling. Defects are the cause of leukocyte adhesion deficiency type I (LAD1).

Protein type: Motility/polarity/chemotaxis; Membrane protein, integral; Cell surface; Receptor, misc.; Cell adhesion

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cell surface; membrane; plasma membrane; receptor complex

Molecular Function: cell adhesion molecule binding; glycoprotein binding; ICAM-3 receptor activity; protein binding; protein kinase binding

Biological Process: cell adhesion; cell-matrix adhesion; extracellular matrix organization and biogenesis; heterotypic cell-cell adhesion; leukocyte adhesion; leukocyte migration; neutrophil chemotaxis; receptor clustering; receptor internalization; regulation of immune response; regulation of peptidyl-tyrosine phosphorylation; toll-like receptor 4 signaling pathway

Disease: Leukocyte Adhesion Deficiency, Type I

Research Articles on ITGB2

Similar Products

Product Notes

The ITGB2 itgb2 (Catalog #AAA1267684) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggcc tgcgcccccc acttctcgcc ctggtggggc tgctctccct cgggtgcgtc ctctctcagg agtgcacgaa gttcaaggtc agcagctgcc gggaatgcat cgagtcgggg cccggctgca cctggtgcca gaagctgaac ttcacagggc cgggggatcc tgactccatt cgctgcgaca cccggccaca gctgctcatg aggggctgtg cggctgacga catcatggac cccacaagcc tcgctgaaac ccaggaagac cacaatgggg gccagaagca gctgtcccca caaaaagtga cgctttacct gcgaccaggc caggcagcag cgttcaacgt gaccttccgg cgggccaagg gctaccccat cgacctgtac tatctgatgg acctctccta ctccatgctt gatgacctca ggaatgtcaa gaagctaggt ggcgacctgc tccgggccct caacgagatc accgagtccg gccgcattgg cttcgggtcc ttcgtggaca agaccgtgct gccgttcgtg aacacgcacc ctgataagct gcgaaaccca tgccccaaca aggagaaaga gtgccagccc ccgtttgcct tcaggcacgt gctgaagctg accaacaact ccaaccagtt tcagaccgag gtcgggaagc agctgatttc cggaaacctg gatgcacccg agggtgggct ggacgccatg atgcaggtcg ccgcctgccc ggaggaaatc ggctggcgca acgtcacgcg gctgctggtg tttgccactg atgacggctt ccatttcgcg ggcgacggga agctgggcgc catcctgacc cccaacgacg gccgctgtca cctggaggac aacttgtaca agaggagcaa cgaattcgac tacccatcgg tgggccagct ggcgcacaag ctggctgaaa acaacatcca gcccatcttc gcggtgacca gtaggatggt gaagacctac gagaaactca ccgagatcat ccccaagtca gccgtggggg agctgtctga ggactccagc aatgtggtcc atctcattaa gaatgcttac aataaactct cctccagggt attcctggat cacaacgccc tccccgacac cctgaaagtc acctacgact ccttctgcag caatggagtg acgcacagga accagcccag aggtgactgt gatggcgtgc agatcaatgt cccgatcacc ttccaggtga aggtcacggc cacagagtgc atccaggagc agtcgtttgt catccgggcg ctgggcttca cggacatagt gaccgtgcag gtccttcccc agtgtgagtg ccggtgccgg gaccagagca gagaccgcag cctctgccat ggcaagggct tcttggagtg cggcatctgc aggtgtgaca ctggctacat tgggaaaaac tgtgagtgcc agacacaggg ccggagcagc caggagctgg aaggaagctg ccggaaggac aacaactcca tcatctgctc agggctgggg gactgtgtct gcgggcagtg cctgtgccac accagcgacg tccccggcaa gctgatatac gggcagtact gcgagtgtga caccatcaac tgtgagcgct acaacggcca ggtctgcggc ggcccgggga gggggctctg cttctgcggg aagtgccgct gccacccggg ctttgagggc tcagcgtgcc agtgcgagag gaccactgag ggctgcctga acccgcggcg tgttgagtgt agtggtcgtg gccggtgccg ctgcaacgta tgcgagtgcc attcaggcta ccagctgcct ctgtgccagg agtgccccgg ctgcccctca ccctgtggca agtacatctc ctgcgccgag tgcctgaagt tcgaaaaggg cccctttggg aagaactgca gcgcggcgtg tccgggcctg cagctgtcga acaaccccgt gaagggcagg acctgcaagg agagggactc agagggctgc tgggtggcct acacgctgga gcagcaggac gggatggacc gctacctcat ctatgtggat gagagccgag agtgtgtggc aggccccaac atcgccgcca tcgtcggggg caccgtggca ggcatcgtgc tgatcggcat tctcctgctg gtcatctgga aggctctgat ccacctgagc gacctccggg agtacaggcg ctttgagaag gagaagctca agtcccagtg gaacaatgat aatccccttt tcaagagcgc caccacgacg gtcatgaacc ccaagtttgc tgagagttag. It is sometimes possible for the material contained within the vial of "ITGB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.