Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAF1 cdna clone

RAF1 cDNA Clone

Gene Names
RAF1; NS5; CRAF; Raf-1; c-Raf; CMD1NN
Synonyms
RAF1; RAF1 cDNA Clone; RAF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcacatacagggagcttggaagacgatcagcaatggttttggattcaaagatgccgtgtttgatggctccagctgcatctctcctacaatagttcagcagtttggctatcagcgccgggcatcagatgatggcaaactcacagatccttctaagacaagcaacactatccgtgttttcttgccgaacaagcaaagaacagtggtcaatgtgcgaaatggaatgagcttgcatgactgccttatgaaagcactcaaggtgaggggcctgcaaccagagtgctgtgcagtgttcagacttctccacgaacacaaaggtaaaaaagcacgcttagattggaatactgatgctgcgtctttgattggagaagaacttcaagtagatttcctggatcatgttcccctcacaacacacaactttgctcggaagacgttcctgaagcttgccttctgtgacatctgtcagaaattcctgctcaatggatttcgatgtcagacttgtggctacaaatttcatgagcactgtagcaccaaagtacctactatgtgtgtggactggagtaacatcagacaactcttattgtttccaaattccactattggtgatagtggagtcccagcactaccttctttgactatgcgtcgtatgcgagagtctgtttccaggatgcctgttagttctcagcacagatattctacacctcacgccttcacctttaacacctccagtccctcatctgaaggttccctctcccagaggcagaggtcgacatccacacctaatgtccacatggtcagcaccaccctgcctgtggacagcaggatgattgaggatgcaattcgaagtcacagcgaatcagcctcaccttcagccctgtccagtagccccaacaatctgagcccaacaggctggtcacagccgaaaacccccgtgccagcacaaagagagcgggcaccagtatctgggacccaggagaaaaacaaaattaggcctcgtggacagagagattcaagctattattgggaaatagaagccagtgaagtgatgctgtccactcggattgggtcaggctcttttggaactgtttataagggtaaatggcacggagatgttgcagtaaagatcctaaaggttgtcgacccaaccccagagcaattccaggccttcaggaatgaggtggctgttctgcgcaaaacacggcatgtgaacattctgcttttcatggggtacatgacaaaggacaacctggcaattgtgacccagtggtgcgagggcagcagcctctacaaacacctgcatgtccaggagaccaagtttcagatgttccagctaattgacattgcccggcagacggctcagggaatggactatttgcatgcaaagaacatcatccatagagacatgaaatccaacaatatatttctccatgaaggcttaacagtgaaaattggagattttggtttggcaacagtaaagtcacgctggagtggttctcagcaggttgaacaacctactggctctgtcctctggatggccccagaggtgatccgaatgcaggataacaacccattcagtttccagtcggatgtctactcctatggcatcgtattgtatgaactgatgacgggggagcttccttattctcacatcaacaaccgagatcagatcatcttcatggtgggccgaggatatgcctccccagatcttagtaagctatataagaactgccccaaagcaatgaagaggctggtagctgactgtgtgaagaaagtaaaggaagagaggcctctttttccccagatcctgtcttccattgagctgctccaacactctctaccgaagatcaaccggagcgcttccgagccatccttgcatcgggcagcccacactgaggatatcaatgcttgcacgctgaccacgtccccgaggctgcctgtcttctag
Sequence Length
1947
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
75,395 Da
NCBI Official Full Name
Homo sapiens v-raf-1 murine leukemia viral oncogene homolog 1, mRNA
NCBI Official Synonym Full Names
Raf-1 proto-oncogene, serine/threonine kinase
NCBI Official Symbol
RAF1
NCBI Official Synonym Symbols
NS5; CRAF; Raf-1; c-Raf; CMD1NN
NCBI Protein Information
RAF proto-oncogene serine/threonine-protein kinase
UniProt Protein Name
RAF proto-oncogene serine/threonine-protein kinase
Protein Family
UniProt Gene Name
RAF1
UniProt Synonym Gene Names
RAF; cRaf
UniProt Entry Name
RAF1_HUMAN

NCBI Description

This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]

Uniprot Description

RAF1: a proto-oncogenic TKL kinase of the RAF family. Functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated Raf-1 can phosphorylate and activate MEK1/2, which in turn phosphorylate and activate ERK1/2. Acts as a regulatory link between the membrane-associated Ras GTPases and the MAPK/ERK cascade, and this critical regulatory link functions as a switch determining cell fate decisions including proliferation, differentiation, apoptosis, survival and oncogenic transformation. RAF1 activation initiates a mitogen-activated protein kinase (MAPK) cascade that comprises a sequential phosphorylation of the dual-specific MAPK kinases (MEK1/2) and the extracellular signal-regulated kinases (ERK1/2). RAF1, subsequent to phosphorylation by PAK1, phosphorylates BAD (Bcl2-antagonist of cell death) at S75. Phosphorylates adenylyl cyclases ADCY2, ADCY5 and ADCY6, resulting in their activation. Phosphorylates PPP1R12A resulting in inhibition of the phosphatase activity. Phosphorylates TNNT2 (cardiac muscle troponin T). Can promote NF-kB activation and inhibit signal transducers involved in motility (ROCK2), apoptosis (ASK1 and MST2), proliferation and angiogenesis (RB1). Can protect cells from apoptosis also by translocating to the mitochondria where it binds BCL2 and displaces BAD. Restricts caspase activation in response to selected stimuli, notably Fas stimulation, pathogen-mediated macrophage apoptosis, and erythroid differentiation.

Protein type: EC 2.7.11.1; Kinase, protein; Oncoprotein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, TKL; RAF family; TKL group

Chromosomal Location of Human Ortholog: 3p25

Cellular Component: cytoplasm; cytosol; Golgi apparatus; mitochondrial outer membrane; plasma membrane

Molecular Function: enzyme binding; identical protein binding; kinase activity; MAP kinase kinase kinase activity; mitogen-activated protein kinase kinase binding; protein binding; protein kinase activity; protein serine/threonine kinase activity; small GTPase binding

Biological Process: activation of MAPKK activity; apoptosis; cell proliferation; MAPKKK cascade; multicellular organismal development; negative regulation of apoptosis; negative regulation of caspase activity; negative regulation of cell proliferation; negative regulation of protein complex assembly; negative regulation of signal transduction; platelet activation; positive regulation of peptidyl-serine phosphorylation; protein amino acid phosphorylation; regulation of apoptosis; regulation of cell differentiation; regulation of Rho protein signal transduction; signal transduction; stimulatory C-type lectin receptor signaling pathway; wound healing

Disease: Cardiomyopathy, Dilated, 1nn; Leopard Syndrome 2; Noonan Syndrome 5

Research Articles on RAF1

Similar Products

Product Notes

The RAF1 raf1 (Catalog #AAA1267671) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcaca tacagggagc ttggaagacg atcagcaatg gttttggatt caaagatgcc gtgtttgatg gctccagctg catctctcct acaatagttc agcagtttgg ctatcagcgc cgggcatcag atgatggcaa actcacagat ccttctaaga caagcaacac tatccgtgtt ttcttgccga acaagcaaag aacagtggtc aatgtgcgaa atggaatgag cttgcatgac tgccttatga aagcactcaa ggtgaggggc ctgcaaccag agtgctgtgc agtgttcaga cttctccacg aacacaaagg taaaaaagca cgcttagatt ggaatactga tgctgcgtct ttgattggag aagaacttca agtagatttc ctggatcatg ttcccctcac aacacacaac tttgctcgga agacgttcct gaagcttgcc ttctgtgaca tctgtcagaa attcctgctc aatggatttc gatgtcagac ttgtggctac aaatttcatg agcactgtag caccaaagta cctactatgt gtgtggactg gagtaacatc agacaactct tattgtttcc aaattccact attggtgata gtggagtccc agcactacct tctttgacta tgcgtcgtat gcgagagtct gtttccagga tgcctgttag ttctcagcac agatattcta cacctcacgc cttcaccttt aacacctcca gtccctcatc tgaaggttcc ctctcccaga ggcagaggtc gacatccaca cctaatgtcc acatggtcag caccaccctg cctgtggaca gcaggatgat tgaggatgca attcgaagtc acagcgaatc agcctcacct tcagccctgt ccagtagccc caacaatctg agcccaacag gctggtcaca gccgaaaacc cccgtgccag cacaaagaga gcgggcacca gtatctggga cccaggagaa aaacaaaatt aggcctcgtg gacagagaga ttcaagctat tattgggaaa tagaagccag tgaagtgatg ctgtccactc ggattgggtc aggctctttt ggaactgttt ataagggtaa atggcacgga gatgttgcag taaagatcct aaaggttgtc gacccaaccc cagagcaatt ccaggccttc aggaatgagg tggctgttct gcgcaaaaca cggcatgtga acattctgct tttcatgggg tacatgacaa aggacaacct ggcaattgtg acccagtggt gcgagggcag cagcctctac aaacacctgc atgtccagga gaccaagttt cagatgttcc agctaattga cattgcccgg cagacggctc agggaatgga ctatttgcat gcaaagaaca tcatccatag agacatgaaa tccaacaata tatttctcca tgaaggctta acagtgaaaa ttggagattt tggtttggca acagtaaagt cacgctggag tggttctcag caggttgaac aacctactgg ctctgtcctc tggatggccc cagaggtgat ccgaatgcag gataacaacc cattcagttt ccagtcggat gtctactcct atggcatcgt attgtatgaa ctgatgacgg gggagcttcc ttattctcac atcaacaacc gagatcagat catcttcatg gtgggccgag gatatgcctc cccagatctt agtaagctat ataagaactg ccccaaagca atgaagaggc tggtagctga ctgtgtgaag aaagtaaagg aagagaggcc tctttttccc cagatcctgt cttccattga gctgctccaa cactctctac cgaagatcaa ccggagcgct tccgagccat ccttgcatcg ggcagcccac actgaggata tcaatgcttg cacgctgacc acgtccccga ggctgcctgt cttctag. It is sometimes possible for the material contained within the vial of "RAF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.