Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C1orf124 cdna clone

C1orf124 cDNA Clone

Gene Names
SPRTN; DVC1; PRO4323; spartan; C1orf124
Synonyms
C1orf124; C1orf124 cDNA Clone; C1orf124 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgatgacttgatgttggcactgcggcttcaggaggagtggaacttgcaggaggcggagcgcgatcatgcccaggagtccctgtcgctagtggacgcgtcgtgggagttggtggaccccacaccggacttgcaggcactgtttgttcagtttaacgaccaattcttctggggccagctggaggccgtcgaggtgaagtggagcgtgcgaatgaccctgtgtgctgggatatgcagctatgaagggaagggtggaatgtgttccatccgtctcagcgaaccccttttgaagttgaggccaagaaaggatcttgtagagaccctcctgcatgaaatgatacatgcctatttatttgtcactaataacgacaaagaccgagaagggcatggtccagaattttgtaaacatatgcatcgcatcaacagcctgactggagccaatataacggtataccatacttttcacgatgaggtggatgagtatcggcgacactggtggcgctgcaatgggccgtgccagcacaggccaccgtattacggctatgtcaaacgagctactaacagggaaccctctgctcatgactattggtgggctgagcaccagaaaacctgtggaggcacttacataaaaatcaaggaaccagagaattactcaaaaaaaggcaaaggaaaggcaaaactaggaaaggaaccagtattggccgcagagaataaaggtaccttcgtgtaa
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,247 Da
NCBI Official Full Name
Homo sapiens chromosome 1 open reading frame 124, mRNA
NCBI Official Synonym Full Names
SprT-like N-terminal domain
NCBI Official Symbol
SPRTN
NCBI Official Synonym Symbols
DVC1; PRO4323; spartan; C1orf124
NCBI Protein Information
sprT-like domain-containing protein Spartan
UniProt Protein Name
SprT-like domain-containing protein Spartan
UniProt Gene Name
SPRTN
UniProt Synonym Gene Names
C1orf124; DVC1; DVC1; Spartan
UniProt Entry Name
SPRTN_HUMAN

NCBI Description

The protein encoded by this gene may play a role in DNA repair during replication of damaged DNA. This protein recruits valosin containing protein (p97) to stalled DNA replication forks where it may prevent excessive translesional DNA synthesis and limit the number of DNA-damage induced mutations. It may also be involved in replication-related G2/M-checkpoint regulation. Deficiency of a similar protein in mouse causes chromosomal instability and progeroid phenotypes. Mutations in this gene have been associated with Ruijs-Aalfs syndrome (RJALS). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]

Uniprot Description

SPRTN: Regulator of UV-induced DNA damage response: acts as a 'reader' of ubiquitinated PCNA that enhances RAD18-mediated PCNA ubiquitination and translesion DNA synthesis. Recruited to sites of UV damage and interacts with ubiquitinated PCNA and RAD18, the E3 ubiquitin ligase that monoubiquitinates PCNA. Facilitates chromatin association of RAD18 and is required for efficient PCNA monoubiquitination, promoting a feed-forward loop to enhance PCNA ubiquitination and translesion DNA synthesis. Also required for localization of DNA polymerase eta (POLH) to sites of UV damage. Belongs to the Spartan family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA repair, damage

Chromosomal Location of Human Ortholog: 1q42.12-q43

Cellular Component: nuclear speck; nucleoplasm; nucleus

Molecular Function: protein binding; ubiquitin binding

Biological Process: bypass DNA synthesis; positive regulation of protein ubiquitination; response to DNA damage stimulus; response to UV

Disease: Ruijs-aalfs Syndrome

Research Articles on C1orf124

Similar Products

Product Notes

The C1orf124 sprtn (Catalog #AAA1267438) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgatg acttgatgtt ggcactgcgg cttcaggagg agtggaactt gcaggaggcg gagcgcgatc atgcccagga gtccctgtcg ctagtggacg cgtcgtggga gttggtggac cccacaccgg acttgcaggc actgtttgtt cagtttaacg accaattctt ctggggccag ctggaggccg tcgaggtgaa gtggagcgtg cgaatgaccc tgtgtgctgg gatatgcagc tatgaaggga agggtggaat gtgttccatc cgtctcagcg aacccctttt gaagttgagg ccaagaaagg atcttgtaga gaccctcctg catgaaatga tacatgccta tttatttgtc actaataacg acaaagaccg agaagggcat ggtccagaat tttgtaaaca tatgcatcgc atcaacagcc tgactggagc caatataacg gtataccata cttttcacga tgaggtggat gagtatcggc gacactggtg gcgctgcaat gggccgtgcc agcacaggcc accgtattac ggctatgtca aacgagctac taacagggaa ccctctgctc atgactattg gtgggctgag caccagaaaa cctgtggagg cacttacata aaaatcaagg aaccagagaa ttactcaaaa aaaggcaaag gaaaggcaaa actaggaaag gaaccagtat tggccgcaga gaataaaggt accttcgtgt aa. It is sometimes possible for the material contained within the vial of "C1orf124, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.