SMUG1 cdna clone

SMUG1 cDNA Clone

Cat. Num. AAA1267393

• Gene Names: SMUG1; FDG; UNG3; HMUDG
• Synonyms: SMUG1; SMUG1 cDNA Clone; SMUG1 cdna clone

• Sequence: atgccccaggctttcctgctggggtccatccatgagcctgcaggtgccctcatggagccccagccctgccctggaagcttggctgagagcttcctggaggaggagcttcggctcaatgctgagctgagccagctgcagttttcggagcctgtgggcatcatctacaatcccgtggagtatgcatgggagccacatcgcaactacgtgactcgctactgccagggccccaaggaagtactcttcctgggcatgaaccctggaccttttggcatggcccagactggggtgccctttggggaagtaagcatggtccgggactggttgggcattgtggggcctgtgctgacccctccccaagagcatcctaaacgaccagtgctgggactggagtgcccacagtcagaaggaccaagacaaagcatgggacatgaaattaagagtgaacttcttatgggaggctgcagctggatcagaggaaaaatccagtgtgacagagtgcaagtcagaagacctggcttttcatcccagctttga
• Sequence Length: 534

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 33875414
• NCBI GeneID: 23583
• Molecular Weight: 19,627 Da
• NCBI Official Full Name: Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1, mRNA
• NCBI Official Synonym Full Names: single-strand-selective monofunctional uracil-DNA glycosylase 1
• NCBI Official Symbol: SMUG1
• NCBI Official Synonym Symbols: FDG; UNG3; HMUDG
• NCBI Protein Information: single-strand selective monofunctional uracil DNA glycosylase
• UniProt Protein Name: Single-strand selective monofunctional uracil DNA glycosylase
• Protein Family: Single-strand selective monofunctional uracil DNA glycosylase
• UniProt Gene Name: SMUG1
• UniProt Entry Name: SMUG1_HUMAN

NCBI Description

This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants. [provided by RefSeq, Aug 2011]

Uniprot Description

SMUG1: Responsible for recognizing base lesions in the genome and initiating base excision DNA repair. Acts as a monofunctional DNA glycosylase specific for uracil (U) residues in DNA and has a preference for single-stranded DNA substrates. The activity is greater against mismatches (U/G) than against matches (U/A). Excised uracil (U), 5-formyluracil (fU) and uracil derivatives bearing an oxidized group at C5 [5-hydroxyuracil (hoU) and 5- hydroxymethyluracil (hmU)] in ssDNA and dsDNA but not analogous cytosine derivatives (5-hydroxycytosine and 5-formylcytosine) and other oxidized damage. The activity is damage specificity and salt concentration-dependent. The general order of the preference for ssDNA and dsDNA is the following: ssDNA > dsDNA (G pair) = dsDNA (A pair) at the low salt concentration. At the high concentration dsDNA (G pair) > dsDNA (A pair) > ssDNA. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.2.2.-; DNA repair, damage; Hydrolase

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: nucleolus; nucleoplasm

Molecular Function: DNA N-glycosylase activity; oxidized pyrimidine base lesion DNA N-glycosylase activity; protein binding; single-strand selective uracil DNA N-glycosylase activity; uracil DNA N-glycosylase activity

Biological Process: base-excision repair; depyrimidination