ILVBL cdna clone
ILVBL cDNA Clone
Gene Names
ILVBL; AHAS; 209L8; ILV2H; HACL1L
Synonyms
ILVBL; ILVBL cDNA Clone; ILVBL cdna clone
Sequence
atggagacccccgcggccgccgcccccgctgggagcttattcccctccttcctgctcctggcctgcgggacgctggtggccgccttgctgggcgccgctcaccgcctggggctcttctatcagctgctgcacaaggtggacaaggcaagcgtccggcatggcggagagaacgtggccgctgtgctgagggcccatggtgtgcggttcatcttcacgctggtcggtgggcacatttccccgctgctggtggcctgtgagaaactgggcatccgtgtggtggacacacgccatgaggtcacggccgtctttgctgctgatgctatggcccgcctgtccgggacggtgggcgtggcggcagtgacagcaggccctggcctcaccaacacggtgactgcggtgaagaatgctcagatggctcagtccccaatcctgcttctgggtggggctgccagcactctgctgcagaaccggggtgcgctccaggctgttgatcagctgtcccttttccggccactctgtaagttttgtgtgtctgtgcggagggtgcgggacattgtgcccaccctgagggccgcgatggctgccgcccagtcgggcaccccaggtccggtgtttgtggagctgcccgttgacgtgctttacccctacttcatggtccagaaggagatggtgccagccaagccacccaagggcctcgtgggccgagtggtctcctggtatttagagaattacctggccaacctctttgcaggagcctgggagcctcagcccgagggaccgctgcccctggacatcccccaggcttccccgcagcaggttcagcgctgtgtggagatcctgagccgggccaagaggcctctgatggtgctggggagtcaggccctgctcaccccaacgtctgccgacaagcttcgggctgccgtggagaccttgggtgttccctgcttccttggagggatggcacgggggctgttaggccgcaaccaccccctccacatccgggagaaccgcagtgcggccctgaagaaggcggatgtcattgtcctagcaggaactgtgtgtgacttccgcctatcctatggccgtgtcctcagccacagcagcaagatcatcatcgtcgatcgtaatcgggaagagatgttgctcaactcagacatcttctggaagccccaggaggctgtgcagggagatgtgggttccttcgtgctgaagttagtggagggccttcagggccagacctgggccccagactgggtggaggagctgcgggaagccgaccggcagaaggagcagacctttcgggagaaggcagcgatgcctgtggcccagcacctgaacccagtgcaggtgctgcagctggtggaggaaacgctacctgacaactcaattctggtggtggatggtggggacttcgtgggcactgctgcccatctggtacagccccgcggccccctgcgctggcttgatcctggggcctttgggactctgggagttggtgcaggatttgcacttggggccaagctgtgccggccagatgctgaggtctggtgcctgtttggggacggagcttttggctacagcctcatcgaatttgatacattcgtcagacacaagatcccagtgatggccttggtagggaatgatgctggctggacacagatttctcgggagcaggtgccctctctgggcagcaacgtggcctgtggcctggcctacactgattatcacaaggcagccatgggtctgggggcccggggcttgctgctctcacgggagaacgaggatcaggtggtcaaggtgctgcacgatgcccagcagcagtgccgagacggccacccggttgtggtcaacatcctcattgggaggacggacttccgcgatggctccattgctgtatag
Sequence Length
1899
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,868 Da
NCBI Official Full Name
Homo sapiens ilvB (bacterial acetolactate synthase)-like, mRNA
NCBI Official Synonym Full Names
ilvB acetolactate synthase like
NCBI Official Symbol
ILVBL
NCBI Official Synonym Symbols
AHAS; 209L8; ILV2H; HACL1L
NCBI Protein Information
acetolactate synthase-like protein
UniProt Protein Name
Acetolactate synthase-like protein
Protein Family
UniProt Gene Name
ILVBL
UniProt Synonym Gene Names
AHAS
UniProt Entry Name
ILVBL_HUMAN
NCBI Description
The protein encoded by this gene shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Uniprot Description
ILVBL: shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Protein type: Transferase; Membrane protein, integral; EC 2.2.1.-
Chromosomal Location of Human Ortholog: 19p13.1
Cellular Component: membrane
Molecular Function: protein binding
Similar Products
Product Notes
The ILVBL ilvbl (Catalog #AAA1267371) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaccc ccgcggccgc cgcccccgct gggagcttat tcccctcctt cctgctcctg gcctgcggga cgctggtggc cgccttgctg ggcgccgctc accgcctggg gctcttctat cagctgctgc acaaggtgga caaggcaagc gtccggcatg gcggagagaa cgtggccgct gtgctgaggg cccatggtgt gcggttcatc ttcacgctgg tcggtgggca catttccccg ctgctggtgg cctgtgagaa actgggcatc cgtgtggtgg acacacgcca tgaggtcacg gccgtctttg ctgctgatgc tatggcccgc ctgtccggga cggtgggcgt ggcggcagtg acagcaggcc ctggcctcac caacacggtg actgcggtga agaatgctca gatggctcag tccccaatcc tgcttctggg tggggctgcc agcactctgc tgcagaaccg gggtgcgctc caggctgttg atcagctgtc ccttttccgg ccactctgta agttttgtgt gtctgtgcgg agggtgcggg acattgtgcc caccctgagg gccgcgatgg ctgccgccca gtcgggcacc ccaggtccgg tgtttgtgga gctgcccgtt gacgtgcttt acccctactt catggtccag aaggagatgg tgccagccaa gccacccaag ggcctcgtgg gccgagtggt ctcctggtat ttagagaatt acctggccaa cctctttgca ggagcctggg agcctcagcc cgagggaccg ctgcccctgg acatccccca ggcttccccg cagcaggttc agcgctgtgt ggagatcctg agccgggcca agaggcctct gatggtgctg gggagtcagg ccctgctcac cccaacgtct gccgacaagc ttcgggctgc cgtggagacc ttgggtgttc cctgcttcct tggagggatg gcacgggggc tgttaggccg caaccacccc ctccacatcc gggagaaccg cagtgcggcc ctgaagaagg cggatgtcat tgtcctagca ggaactgtgt gtgacttccg cctatcctat ggccgtgtcc tcagccacag cagcaagatc atcatcgtcg atcgtaatcg ggaagagatg ttgctcaact cagacatctt ctggaagccc caggaggctg tgcagggaga tgtgggttcc ttcgtgctga agttagtgga gggccttcag ggccagacct gggccccaga ctgggtggag gagctgcggg aagccgaccg gcagaaggag cagacctttc gggagaaggc agcgatgcct gtggcccagc acctgaaccc agtgcaggtg ctgcagctgg tggaggaaac gctacctgac aactcaattc tggtggtgga tggtggggac ttcgtgggca ctgctgccca tctggtacag ccccgcggcc ccctgcgctg gcttgatcct ggggcctttg ggactctggg agttggtgca ggatttgcac ttggggccaa gctgtgccgg ccagatgctg aggtctggtg cctgtttggg gacggagctt ttggctacag cctcatcgaa tttgatacat tcgtcagaca caagatccca gtgatggcct tggtagggaa tgatgctggc tggacacaga tttctcggga gcaggtgccc tctctgggca gcaacgtggc ctgtggcctg gcctacactg attatcacaa ggcagccatg ggtctggggg cccggggctt gctgctctca cgggagaacg aggatcaggt ggtcaaggtg ctgcacgatg cccagcagca gtgccgagac ggccacccgg ttgtggtcaa catcctcatt gggaggacgg acttccgcga tggctccatt gctgtatag. It is sometimes possible for the material contained within the vial of "ILVBL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
