LIX1 cdna clone
LIX1 cDNA Clone
Gene Names
LIX1; Lft; C5orf11
Synonyms
LIX1; LIX1 cDNA Clone; LIX1 cdna clone
Sequence
atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcactgccagctcctgggcctccctttgtgagttacgtgaccctcccagggggaagctgttttggcaactttcagtgctgcttaagtagagccgaggccaggcgggatgcagctaaagtggccctgatcaactccctcttcaatgagctgccctctcgcaggatcaccaaggaattcattatggaaagtgttcaggaagcagtagcctccaccagcggcaccttagatgatgcagatgaccccagcaccagtgttggggcctatcactacatgctggagtcaaacatggggaagactatgctggagtttcaggagctgatgaccattttccaactattgcactggaatggaagcctaaaagcccttcgtgaaacaaagtgttcccgacaggaagtcatctcctactattctcagtattctctagatgaaaagatgcgcagccacatggccctggactggatcatgaaggagcgggactcaccaggaattgtctctcaagagctacgaatggccctgaggcagttggaggaagccaggaaagcaggacaagaactacggttttacaaagaaaagaaagaaatattgagcttagccctgactcagatctgcagtgaccctgacacttcctcacccagtgatgatcagctgagccttacggccctgtgtggctatcactag
Sequence Length
849
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,891 Da
NCBI Official Full Name
Homo sapiens Lix1 homolog (chicken), mRNA
NCBI Official Synonym Full Names
limb and CNS expressed 1
NCBI Official Symbol
LIX1
NCBI Official Synonym Symbols
Lft; C5orf11
NCBI Protein Information
protein limb expression 1 homolog
UniProt Protein Name
Protein limb expression 1 homolog
Protein Family
UniProt Gene Name
LIX1
UniProt Synonym Gene Names
C5orf11
UniProt Entry Name
LIX1_HUMAN
Uniprot Description
LIX1: Belongs to the LIX1 family.
Chromosomal Location of Human Ortholog: 5q15
Cellular Component: cytoplasm
Research Articles on LIX1
Similar Products
Product Notes
The LIX1 lix1 (Catalog #AAA1267340) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacataa ccttggaatc tctgagacac atcattgccc aagtcttgcc tcacagagat ccggctctag tcttcaaaga cttgaacgtt gtgtcaatgt tacaggaatt ttgggaaagc aagcagcagc agaaggctgc attcccaagt gaaggtgtgg tggtctatga gtcactgcca gctcctgggc ctccctttgt gagttacgtg accctcccag ggggaagctg ttttggcaac tttcagtgct gcttaagtag agccgaggcc aggcgggatg cagctaaagt ggccctgatc aactccctct tcaatgagct gccctctcgc aggatcacca aggaattcat tatggaaagt gttcaggaag cagtagcctc caccagcggc accttagatg atgcagatga ccccagcacc agtgttgggg cctatcacta catgctggag tcaaacatgg ggaagactat gctggagttt caggagctga tgaccatttt ccaactattg cactggaatg gaagcctaaa agcccttcgt gaaacaaagt gttcccgaca ggaagtcatc tcctactatt ctcagtattc tctagatgaa aagatgcgca gccacatggc cctggactgg atcatgaagg agcgggactc accaggaatt gtctctcaag agctacgaat ggccctgagg cagttggagg aagccaggaa agcaggacaa gaactacggt tttacaaaga aaagaaagaa atattgagct tagccctgac tcagatctgc agtgaccctg acacttcctc acccagtgat gatcagctga gccttacggc cctgtgtggc tatcactag. It is sometimes possible for the material contained within the vial of "LIX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
