Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TP63 cdna clone

TP63 cDNA Clone

Gene Names
TP63; AIS; KET; LMS; NBP; RHS; p40; p51; p63; EEC3; OFC8; p73H; p73L; SHFM4; TP53L; TP73L; p53CP; TP53CP; B(p51A); B(p51B)
Synonyms
TP63; TP63 cDNA Clone; TP63 cdna clone
Ordering
For Research Use Only!
Sequence
atgaattttgaaacttcacggtgtgccaccctacagtactgccctgacccttacatccagcgtttcgtagaaaccccagctcatttctcttggaaagaaagttattaccgatccaccatgtcccagagcacacagacaaatgaattcctcagtccagaggttttccagcatatctgggattttctggaacagcctatatgttcagttcagcccattgacttgaactttgtggatgaaccatcagaagatggtgcgacaaacaagattgagattagcatggactgtatccgcatgcaggactcggacctgagtgaccccatgtggccacagtacacgaacctggggctcctgaacagcatggaccagcagattcagaacggctcctcgtccaccagtccctataacacagaccacgcgcagaacagcgtcacggcgccctcgccctacgcacagcccagctccaccttcgatgctctctctccatcacccgccatcccctccaacaccgactacccaggcccgcacagtttcgacgtgtccttccagcagtcgagcaccgccaagtcggccacctggacgtattccactgaactgaagaaactctactgccaaattgcaaagacatgccccatccagatcaaggtgatgaccccacctcctcagggagctgttatccgcgccatgcctgtctacaaaaaagctgagcacgtcacggaggtggtgaagcggtgccccaaccatgagctgagccgtgaattcaacgagggacagattgcccctcctagtcatttgattcgagtagaggggaacagccatgcccagtatgtagaagatcccatcacaggaagacagagtgtgctggtaccttatgagccaccccaggttggcactgaattcacgacagtcttgtacaatttcatgtgtaacagcagttgtgttggagggatgaaccgccgtccaattttaatcattgttactctggaaaccagagatgggcaagtcctgggccgacgctgctttgaggcccggatctgtgcttgcccaggaagagacaggaaggcggatgaagatagcatcagaaagcagcaagtttcggacagtacaaagaacggtgatggtacgaagcgcccgtttcgtcagaacacacatggtatccagatgacatccatcaagaaacgaagatccccagatgatgaactgttatacttaccagtgaggggccgtgagacttatgaaatgctgttgaagatcaaagagtccctggaactcatgcagtaccttcctcagcacacaattgaaacgtacaggcaacagcaacagcagcagcaccagcacttacttcagaaacagacctcaatacagtctccatcttcatatggtaacagctccccacctctgaacaaaatgaacagcatgaacaagctgccttctgtgagccagcttatcaaccctcagcagcgcaacgccctcactcctacaaccattcctgatggcatgggagccaacattcccatgatgggcacccacatgccaatggctggagacatgaatggactcagccccacccaggcactccctcccccactctccatgccatccacctcccactgcacacccccacctccgtatcccacagattgcagcattgtcagtttcttagcgaggttgggctgttcatcatgtctggactatttcacgacccaggggctgaccaccatctatcagattgagcattactccatggatgatctggcaagtctgaaaatccctgagcaatttcgacatgcgatctggaagggcatcctggaccaccggcagctccacgaattctcctccccttctcatctcctgcggaccccaagcagtgcctctacagtcagtgtgggctccagtgagacccggggtgagcgtgttattgatgctgtgcgattcaccctccgccagaccatctctttcccaccccgagatgagtggaatgacttcaactttgacatggatgctcgccgcaataagcaacagcgcatcaaagaggagggggagtga
Sequence Length
2043
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,288 Da
NCBI Official Full Name
Homo sapiens tumor protein p63, mRNA
NCBI Official Synonym Full Names
tumor protein p63
NCBI Official Symbol
TP63
NCBI Official Synonym Symbols
AIS; KET; LMS; NBP; RHS; p40; p51; p63; EEC3; OFC8; p73H; p73L; SHFM4; TP53L; TP73L; p53CP; TP53CP; B(p51A); B(p51B)
NCBI Protein Information
tumor protein 63
UniProt Protein Name
Tumor protein 63
Protein Family
UniProt Gene Name
TP63
UniProt Synonym Gene Names
KET; P63; P73H; P73L; TP73L; p63; CUSP; TP63; p73L
UniProt Entry Name
P63_HUMAN

NCBI Description

This gene encodes a member of the p53 family of transcription factors. The functional domains of p53 family proteins include an N-terminal transactivation domain, a central DNA-binding domain and an oligomerization domain. Alternative splicing of this gene and the use of alternative promoters results in multiple transcript variants encoding different isoforms that vary in their functional properties. These isoforms function during skin development and maintenance, adult stem/progenitor cell regulation, heart development and premature aging. Some isoforms have been found to protect the germline by eliminating oocytes or testicular germ cells that have suffered DNA damage. Mutations in this gene are associated with ectodermal dysplasia, and cleft lip/palate syndrome 3 (EEC3); split-hand/foot malformation 4 (SHFM4); ankyloblepharon-ectodermal defects-cleft lip/palate; ADULT syndrome (acro-dermato-ungual-lacrimal-tooth); limb-mammary syndrome; Rap-Hodgkin syndrome (RHS); and orofacial cleft 8. [provided by RefSeq, Aug 2016]

Uniprot Description

p63: Acts as a sequence specific DNA binding transcriptional activator or repressor. The isoforms contain a varying set of transactivation and auto-regulating transactivation inhibiting domains thus showing an isoform specific activity. Isoform 2 activates RIPK4 transcription. May be required in conjunction with TP73/p73 for initiation of p53/TP53 dependent apoptosis in response to genotoxic insults and the presence of activated oncogenes. Involved in Notch signaling by probably inducing JAG1 and JAG2. Plays a role in the regulation of epithelial morphogenesis. The ratio of DeltaN-type and TA*-type isoforms may govern the maintenance of epithelial stem cell compartments and regulate the initiation of epithelial stratification from the undifferentiated embryonal ectoderm. Required for limb formation from the apical ectodermal ridge. Activates transcription of the p21 promoter. Binds DNA as a homotetramer. Isoform composition of the tetramer may determine transactivation activity. Isoforms Alpha and Gamma interact with HIPK2. Interacts with SSRP1, leading to stimulate coactivator activity. Isoform 1 and isoform 2 interact with WWP1. Interacts with PDS5A. Isoform 5 (via activation domain) interacts with NOC2L. Widely expressed, notably in heart, kidney, placenta, prostate, skeletal muscle, testis and thymus, although the precise isoform varies according to tissue type. Progenitor cell layers of skin, breast, eye and prostate express high levels of DeltaN-type isoforms. Isoform 10 is predominantly expressed in skin squamous cell carcinomas, but not in normal skin tissues. Belongs to the p53 family. 12 isoforms of the human protein are produced by alternative promoter.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 3q28

Cellular Component: cytoplasm; cytosol; dendrite; nuclear chromatin; nucleoplasm; nucleus; transcription factor complex

Molecular Function: damaged DNA binding; double-stranded DNA binding; identical protein binding; p53 binding; protein binding; sequence-specific DNA binding; transcription factor activity; WW domain binding

Biological Process: apoptosis; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator; G1 DNA damage checkpoint; negative regulation of apoptosis; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of Notch signaling pathway; positive regulation of osteoblast differentiation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein homotetramerization; regulation of apoptosis; regulation of epidermal cell division; regulation of neuron apoptosis; response to gamma radiation; response to X-ray

Disease: Adult Syndrome; Ankyloblepharon-ectodermal Defects-cleft Lip/palate; Ectrodactyly, Ectodermal Dysplasia, And Cleft Lip/palate Syndrome 3; Limb-mammary Syndrome; Rapp-hodgkin Syndrome; Split-hand/foot Malformation 4

Research Articles on TP63

Similar Products

Product Notes

The TP63 tp63 (Catalog #AAA1267334) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattttg aaacttcacg gtgtgccacc ctacagtact gccctgaccc ttacatccag cgtttcgtag aaaccccagc tcatttctct tggaaagaaa gttattaccg atccaccatg tcccagagca cacagacaaa tgaattcctc agtccagagg ttttccagca tatctgggat tttctggaac agcctatatg ttcagttcag cccattgact tgaactttgt ggatgaacca tcagaagatg gtgcgacaaa caagattgag attagcatgg actgtatccg catgcaggac tcggacctga gtgaccccat gtggccacag tacacgaacc tggggctcct gaacagcatg gaccagcaga ttcagaacgg ctcctcgtcc accagtccct ataacacaga ccacgcgcag aacagcgtca cggcgccctc gccctacgca cagcccagct ccaccttcga tgctctctct ccatcacccg ccatcccctc caacaccgac tacccaggcc cgcacagttt cgacgtgtcc ttccagcagt cgagcaccgc caagtcggcc acctggacgt attccactga actgaagaaa ctctactgcc aaattgcaaa gacatgcccc atccagatca aggtgatgac cccacctcct cagggagctg ttatccgcgc catgcctgtc tacaaaaaag ctgagcacgt cacggaggtg gtgaagcggt gccccaacca tgagctgagc cgtgaattca acgagggaca gattgcccct cctagtcatt tgattcgagt agaggggaac agccatgccc agtatgtaga agatcccatc acaggaagac agagtgtgct ggtaccttat gagccacccc aggttggcac tgaattcacg acagtcttgt acaatttcat gtgtaacagc agttgtgttg gagggatgaa ccgccgtcca attttaatca ttgttactct ggaaaccaga gatgggcaag tcctgggccg acgctgcttt gaggcccgga tctgtgcttg cccaggaaga gacaggaagg cggatgaaga tagcatcaga aagcagcaag tttcggacag tacaaagaac ggtgatggta cgaagcgccc gtttcgtcag aacacacatg gtatccagat gacatccatc aagaaacgaa gatccccaga tgatgaactg ttatacttac cagtgagggg ccgtgagact tatgaaatgc tgttgaagat caaagagtcc ctggaactca tgcagtacct tcctcagcac acaattgaaa cgtacaggca acagcaacag cagcagcacc agcacttact tcagaaacag acctcaatac agtctccatc ttcatatggt aacagctccc cacctctgaa caaaatgaac agcatgaaca agctgccttc tgtgagccag cttatcaacc ctcagcagcg caacgccctc actcctacaa ccattcctga tggcatggga gccaacattc ccatgatggg cacccacatg ccaatggctg gagacatgaa tggactcagc cccacccagg cactccctcc cccactctcc atgccatcca cctcccactg cacaccccca cctccgtatc ccacagattg cagcattgtc agtttcttag cgaggttggg ctgttcatca tgtctggact atttcacgac ccaggggctg accaccatct atcagattga gcattactcc atggatgatc tggcaagtct gaaaatccct gagcaatttc gacatgcgat ctggaagggc atcctggacc accggcagct ccacgaattc tcctcccctt ctcatctcct gcggacccca agcagtgcct ctacagtcag tgtgggctcc agtgagaccc ggggtgagcg tgttattgat gctgtgcgat tcaccctccg ccagaccatc tctttcccac cccgagatga gtggaatgac ttcaactttg acatggatgc tcgccgcaat aagcaacagc gcatcaaaga ggagggggag tga. It is sometimes possible for the material contained within the vial of "TP63, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.