Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP20 cdna clone

USP20 cDNA Clone

Gene Names
USP20; VDU2; hVDU2; LSFR3A
Synonyms
USP20; USP20 cDNA Clone; USP20 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggactccagggacctttgccctcaccttgactccataggagaggtgaccaaagaggacttgctgctcaaatctaagggaacctgtcagtcgtgtggggtcaccggaccaaacctatgggcctgtctgcaggttgcctgcccctatgttggctgcggagaatccttcgctgaccacagcaccattcatgcacaggcaaaaaagcacaacttgaccgtgaacctgaccacgttccgactgtggtgttacgcctgtgagaaggaggtattcctggagcagcggctggcagcccctctgctgggctcctcttccaagttctctgaacaggactccccgccaccctcccaccctctgaaagctgttcctattgctgtggctgatgaaggagagtctgagtcagaggatgatgacctgaaacctcgaggcctcacgggcatgaagaacctcgggaactcctgctacatgaacgccgccctgcaggccctgtccaattgcccgccgctgactcagttcttcttggagtgtggcggcctggtgcgcacagataagaagccagccctgtgcaagagctaccagaagctggtctctgaggtctggcataagaaacggccaagctacgtggtccccaccagtctgtctcatgggatcaagttggtcaacccaatgttccgaggctatgcccagcaggacacccaagagttccttcgctgcctgatggaccagctgcacgaggagctcaaggagccggtggtggccacggtggcgctgacggaggctcgggactcagattcgagtgacacggatgagaaacgggagggtgaccggagcccatcagaagatgagttcttgtcctgtgactcgagcagtgaccggggtgagggtgacgggcaggggcgtggcgggggcagctcgcaggccgagacggagctgctgatcccagatgaggcgggccgagccatctctgagaaggagcggatgaaggaccgcaagttctcctggggccagcagcgtacaaactcggagcaagtggacgaggacgctgatgtggacactgccatggctgcccttgaccagcccgcggaggcccagcccccgtcaccacggtcctccagcccctgccggacgccagagccggacaatgatgctcacctacgcagctcctctcgcccctgcagccccgtccaccaccacgagggccatgccaagctgtctagcagcccccctcgtgcaagccccgtgaggatggcaccgtcgtacgtgctcaagaaagcccaggtattgagtgctggcagccggaggcggaaggagcagcgctaccgcagcgtcatctcagacatctttgacggctccattctcagcctcgtgcagtgtctcacctgtgaccgggtatccaccacagtggaaacgttccaggacttatcactgcccattcctggaaaggaggacctggccaagctccattcagccatctaccagaatgtgccggccaagccaggcgcctgtggggacagctatgccgcccagggctggctggccttcattgtggagtacatccgacggtttgtggtatcctgtacccccagctggttttgggggcctgtcgtcaccctggaagactgccttgctgccttctttgccgctgatgagttaaagggtgacaacatgtacagctgtgagcggtgtaagaagctgcggaacggagtgaagtactgcaaagtcctgcggttgcccgagatcctgtgcattcacctaaagcgctttcggcacgaggtgatgtactcattcaagatcaacagccacgtctccttccccctcgaggggctcgacctgcgccccttccttgccaaggagtgcacatcccagatcaccacctacgacctcctctcggtcatctgccaccacggcacggcaggcagtgggcactacatcgcctactgccagaacgtgatcaatgggcagtggtacgagtttgatgaccagtacgtcacagaagtccacgagacggtggtgcagaacgccgagggctacgtactcttctacaggaagagcagcgaggaggccatgcgggagcgacagcaggtggtgtccctggccgccatgcgggagcccagcctgctgcggttctacgtgtcccgcgagtggctcaacaagttcaacaccttcgcggagccaggccccatcaccaaccagaccttcctctgctcccacggaggcatcccgccccacaaataccactacatcgacgacctggtggtcatcctgccccagaacgtctgggagcacctgtacaacagattcgggggtggccccgccgtgaaccacctgtacgtgtgctccatctgccaggtggagatcgaggcactggccaagcgcaggaggatcgagatcgacaccttcatcaagttgaacaaggccttccaggccgaggagtcgccgggcgtcatctactgcatcagcatgcagtggttccgggagtgggaggcgttcgtcaaggggaaggacaacgagccccccgggcccattgacaacagcaggattgcacaggtcaaaggaagcggccatgtccagctgaagcagggagctgactacgggcagatttcggaggagacctggacctacctgaacagcctgtatggaggtggccccgagattgccatccgccagagtgtggcgcagccgctgggcccagagaacctgcacggggagcagaagatcgaagccgagacgcgggccgtgtga
Sequence Length
2742
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
102,003 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 20, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 20
NCBI Official Symbol
USP20
NCBI Official Synonym Symbols
VDU2; hVDU2; LSFR3A
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 20
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 20
UniProt Gene Name
USP20
UniProt Synonym Gene Names
KIAA1003; LSFR3A; VDU2; hVDU2
UniProt Entry Name
UBP20_HUMAN

NCBI Description

This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]

Uniprot Description

USP20: Deubiquitinating enzyme involved in beta-2 adrenergic receptor (ADRB2) recycling. Acts as a regulator of G-protein coupled receptor (GPCR) signaling by mediating the deubiquitination beta-2 adrenergic receptor (ADRB2). Plays a central role in ADRB2 recycling and resensitization after prolonged agonist stimulation by constitutively binding ADRB2, mediating deubiquitination of ADRB2 and inhibiting lysosomal trafficking of ADRB2. Upon dissociation, it is probably transferred to the translocated beta-arrestins, possibly leading to beta-arrestins deubiquitination and disengagement from ADRB2. This suggests the existence of a dynamic exchange between the ADRB2 and beta-arrestins. Deubiquitinates DIO2, thereby regulating thyroid hormone regulation. Deubiquitinates HIF1A, leading to stabilize HIF1A and enhance HIF1A-mediated activity. Mediates deubiquitination of both 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. Belongs to the peptidase C19 family. USP20/USP33 subfamily.

Protein type: Protease; Ubiquitin conjugating system; Ubiquitin-specific protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: centrosome

Molecular Function: cysteine-type endopeptidase activity; G-protein-coupled receptor binding; protein binding

Biological Process: protein deubiquitination; regulation of G-protein coupled receptor protein signaling pathway

Research Articles on USP20

Similar Products

Product Notes

The USP20 usp20 (Catalog #AAA1267300) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggact ccagggacct ttgccctcac cttgactcca taggagaggt gaccaaagag gacttgctgc tcaaatctaa gggaacctgt cagtcgtgtg gggtcaccgg accaaaccta tgggcctgtc tgcaggttgc ctgcccctat gttggctgcg gagaatcctt cgctgaccac agcaccattc atgcacaggc aaaaaagcac aacttgaccg tgaacctgac cacgttccga ctgtggtgtt acgcctgtga gaaggaggta ttcctggagc agcggctggc agcccctctg ctgggctcct cttccaagtt ctctgaacag gactccccgc caccctccca ccctctgaaa gctgttccta ttgctgtggc tgatgaagga gagtctgagt cagaggatga tgacctgaaa cctcgaggcc tcacgggcat gaagaacctc gggaactcct gctacatgaa cgccgccctg caggccctgt ccaattgccc gccgctgact cagttcttct tggagtgtgg cggcctggtg cgcacagata agaagccagc cctgtgcaag agctaccaga agctggtctc tgaggtctgg cataagaaac ggccaagcta cgtggtcccc accagtctgt ctcatgggat caagttggtc aacccaatgt tccgaggcta tgcccagcag gacacccaag agttccttcg ctgcctgatg gaccagctgc acgaggagct caaggagccg gtggtggcca cggtggcgct gacggaggct cgggactcag attcgagtga cacggatgag aaacgggagg gtgaccggag cccatcagaa gatgagttct tgtcctgtga ctcgagcagt gaccggggtg agggtgacgg gcaggggcgt ggcgggggca gctcgcaggc cgagacggag ctgctgatcc cagatgaggc gggccgagcc atctctgaga aggagcggat gaaggaccgc aagttctcct ggggccagca gcgtacaaac tcggagcaag tggacgagga cgctgatgtg gacactgcca tggctgccct tgaccagccc gcggaggccc agcccccgtc accacggtcc tccagcccct gccggacgcc agagccggac aatgatgctc acctacgcag ctcctctcgc ccctgcagcc ccgtccacca ccacgagggc catgccaagc tgtctagcag cccccctcgt gcaagccccg tgaggatggc accgtcgtac gtgctcaaga aagcccaggt attgagtgct ggcagccgga ggcggaagga gcagcgctac cgcagcgtca tctcagacat ctttgacggc tccattctca gcctcgtgca gtgtctcacc tgtgaccggg tatccaccac agtggaaacg ttccaggact tatcactgcc cattcctgga aaggaggacc tggccaagct ccattcagcc atctaccaga atgtgccggc caagccaggc gcctgtgggg acagctatgc cgcccagggc tggctggcct tcattgtgga gtacatccga cggtttgtgg tatcctgtac ccccagctgg ttttgggggc ctgtcgtcac cctggaagac tgccttgctg ccttctttgc cgctgatgag ttaaagggtg acaacatgta cagctgtgag cggtgtaaga agctgcggaa cggagtgaag tactgcaaag tcctgcggtt gcccgagatc ctgtgcattc acctaaagcg ctttcggcac gaggtgatgt actcattcaa gatcaacagc cacgtctcct tccccctcga ggggctcgac ctgcgcccct tccttgccaa ggagtgcaca tcccagatca ccacctacga cctcctctcg gtcatctgcc accacggcac ggcaggcagt gggcactaca tcgcctactg ccagaacgtg atcaatgggc agtggtacga gtttgatgac cagtacgtca cagaagtcca cgagacggtg gtgcagaacg ccgagggcta cgtactcttc tacaggaaga gcagcgagga ggccatgcgg gagcgacagc aggtggtgtc cctggccgcc atgcgggagc ccagcctgct gcggttctac gtgtcccgcg agtggctcaa caagttcaac accttcgcgg agccaggccc catcaccaac cagaccttcc tctgctccca cggaggcatc ccgccccaca aataccacta catcgacgac ctggtggtca tcctgcccca gaacgtctgg gagcacctgt acaacagatt cgggggtggc cccgccgtga accacctgta cgtgtgctcc atctgccagg tggagatcga ggcactggcc aagcgcagga ggatcgagat cgacaccttc atcaagttga acaaggcctt ccaggccgag gagtcgccgg gcgtcatcta ctgcatcagc atgcagtggt tccgggagtg ggaggcgttc gtcaagggga aggacaacga gccccccggg cccattgaca acagcaggat tgcacaggtc aaaggaagcg gccatgtcca gctgaagcag ggagctgact acgggcagat ttcggaggag acctggacct acctgaacag cctgtatgga ggtggccccg agattgccat ccgccagagt gtggcgcagc cgctgggccc agagaacctg cacggggagc agaagatcga agccgagacg cgggccgtgt ga. It is sometimes possible for the material contained within the vial of "USP20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.