Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MFI2 cdna clone

MFI2 cDNA Clone

Gene Names
MELTF; MTf; MFI2; MTF1; CD228; MAP97
Synonyms
MFI2; MFI2 cDNA Clone; MFI2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggggtccgagcggggctctgtggctgctcctggctctgcgcaccgtgctcggtggcatggaggtgcggtggtgcgccacctcggacccagagcagcacaagtgcggcaacatgagcgaggccttccgggaagcgggcatccagccctccctcctctgcgtccggggcacctccgccgaccactgcgtccagctcatcgcggcccaggaggctgacgccatcactctggatggaggagccatctatgaggcgggaaaggagcacggcctgaagccggtggtgggcgaagtgtacgatcaagaggtcggtacctcctattacgccgtggctgtggtcaggaggagctcccatgtgaccattgacaccctgaaaggcgtgaagtcctgccacacgggcatcaatcgcacagtgggctggaacgtgcccgtgggctacctggtggagagcggccgcctctcggtgatgggctgcgatgtactcaaagctgtcagcgactattttgggggcagctgcgtcccgggggcaggagagaccagttactctgagtccctctgtcgcctctgcaggggtgacagctctggggaaggggtgtgtgacaagagccccctggagagatactacgactacagcggggccttccggtgcctggcggaaggggcaggggacgtggcttttgtgaagcacagcacggtactggagaacacggatgaaagtccatcacgaaggcaaacatggaccagatctgaggaggaagaaggcgagtgccctgcacacgaggaagcacgtaggacgatgcgctctagtgctgggcaagcctggaaatgggctcccgttcacaggccccaggacgagtctgacaaaggagaatttggaaaacgggcaaagagtagggatatgttgggttaa
Sequence Length
909
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,723 Da
NCBI Official Full Name
Homo sapiens antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5, mRNA
NCBI Official Synonym Full Names
melanotransferrin
NCBI Official Symbol
MELTF
NCBI Official Synonym Symbols
MTf; MFI2; MTF1; CD228; MAP97
NCBI Protein Information
melanotransferrin
UniProt Protein Name
Melanotransferrin
UniProt Gene Name
MELTF
UniProt Entry Name
TRFM_HUMAN

NCBI Description

The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

MFI2: Involved in iron cellular uptake. Seems to be internalized and then recycled back to the cell membrane. Binds a single atom of iron per subunit. Could also bind zinc. Belongs to the transferrin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 3q28-q29

Cellular Component: anchored to plasma membrane; cell surface; integral to plasma membrane

Molecular Function: iron ion binding; protein binding

Biological Process: regulation of cell growth; regulation of cell proliferation

Research Articles on MFI2

Similar Products

Product Notes

The MFI2 meltf (Catalog #AAA1267181) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggggtc cgagcggggc tctgtggctg ctcctggctc tgcgcaccgt gctcggtggc atggaggtgc ggtggtgcgc cacctcggac ccagagcagc acaagtgcgg caacatgagc gaggccttcc gggaagcggg catccagccc tccctcctct gcgtccgggg cacctccgcc gaccactgcg tccagctcat cgcggcccag gaggctgacg ccatcactct ggatggagga gccatctatg aggcgggaaa ggagcacggc ctgaagccgg tggtgggcga agtgtacgat caagaggtcg gtacctccta ttacgccgtg gctgtggtca ggaggagctc ccatgtgacc attgacaccc tgaaaggcgt gaagtcctgc cacacgggca tcaatcgcac agtgggctgg aacgtgcccg tgggctacct ggtggagagc ggccgcctct cggtgatggg ctgcgatgta ctcaaagctg tcagcgacta ttttgggggc agctgcgtcc cgggggcagg agagaccagt tactctgagt ccctctgtcg cctctgcagg ggtgacagct ctggggaagg ggtgtgtgac aagagccccc tggagagata ctacgactac agcggggcct tccggtgcct ggcggaaggg gcaggggacg tggcttttgt gaagcacagc acggtactgg agaacacgga tgaaagtcca tcacgaaggc aaacatggac cagatctgag gaggaagaag gcgagtgccc tgcacacgag gaagcacgta ggacgatgcg ctctagtgct gggcaagcct ggaaatgggc tcccgttcac aggccccagg acgagtctga caaaggagaa tttggaaaac gggcaaagag tagggatatg ttgggttaa. It is sometimes possible for the material contained within the vial of "MFI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.