Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DOK5 cdna clone

DOK5 cDNA Clone

Gene Names
DOK5; IRS6; IRS-6; C20orf180
Synonyms
DOK5; DOK5 cDNA Clone; DOK5 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtgtgtaggaacacggatcaatgacatcagccttggagagcctgacttactggccactggggttgagagagaacagagtgagagattcaatgtgtatttgatgccatctcctaacttagatgtacatggcgaatgtgccttgcagattacatatgagtatatctgtctttgggacgtccagaatcccagagtcaaactcatctcttggccgctaagcgccctgcggcggtatggacgtgatactacgtggttcacttttgaggcagggaggatgtgtgagactggtgaagggctgtttatctttcagacccgagacggggaggccatctatcagaaagtccactctgctgccttggccatagccgagcagcacgagcgcttgctacagagtgtgaaaaactcgatgctccagatgaagatgagtgagcgggccgcctcgctgagcaccatggtgcccctgcctcgcagcgcctactggcagcacatcacacggcagcacagcacgggacagctctaccgcttgcaagatgtttccagccctctgaagcttcatcgaacagagacttttccagcctacagatctgagcactga
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,824 Da
NCBI Official Full Name
Homo sapiens docking protein 5, mRNA
NCBI Official Synonym Full Names
docking protein 5
NCBI Official Symbol
DOK5
NCBI Official Synonym Symbols
IRS6; IRS-6; C20orf180
NCBI Protein Information
docking protein 5
UniProt Protein Name
Docking protein 5
Protein Family
UniProt Gene Name
DOK5
UniProt Synonym Gene Names
C20orf180; IRS-6; IRS6
UniProt Entry Name
DOK5_HUMAN

NCBI Description

The protein encoded by this gene is a member of the DOK family of membrane proteins, which are adapter proteins involved in signal transduction. The encoded protein interacts with phosphorylated receptor tyrosine kinases to mediate neurite outgrowth and activation of the MAP kinase pathway. Unlike other DOK family proteins, this protein does not interact with RASGAP. This protein is up-regulated in patients with systemic sclerosis and is associated with fibrosis induced by insulin-like growth factor binding protein 5. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Uniprot Description

DOK5: docking proteins are enzymatically inert adaptor or scaffolding proteins. They provide a docking platform for the assembly of multimolecular signaling complexes. DOK5 functions in Ret-mediated neurite outgrowth and plays a positive role in activation of the MAP kinase pathway. Putative link with downstream effectors of Ret in neuronal differentiation. Interacts with phosphorylated Ret. In contrast to other DOK proteins, it does not interact with RASGAP. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 20q13.2

Biological Process: regulation of nerve growth factor receptor signaling pathway

Research Articles on DOK5

Similar Products

Product Notes

The DOK5 dok5 (Catalog #AAA1267172) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtgtg taggaacacg gatcaatgac atcagccttg gagagcctga cttactggcc actggggttg agagagaaca gagtgagaga ttcaatgtgt atttgatgcc atctcctaac ttagatgtac atggcgaatg tgccttgcag attacatatg agtatatctg tctttgggac gtccagaatc ccagagtcaa actcatctct tggccgctaa gcgccctgcg gcggtatgga cgtgatacta cgtggttcac ttttgaggca gggaggatgt gtgagactgg tgaagggctg tttatctttc agacccgaga cggggaggcc atctatcaga aagtccactc tgctgccttg gccatagccg agcagcacga gcgcttgcta cagagtgtga aaaactcgat gctccagatg aagatgagtg agcgggccgc ctcgctgagc accatggtgc ccctgcctcg cagcgcctac tggcagcaca tcacacggca gcacagcacg ggacagctct accgcttgca agatgtttcc agccctctga agcttcatcg aacagagact tttccagcct acagatctga gcactga. It is sometimes possible for the material contained within the vial of "DOK5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.