Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PINX1 cdna clone

PINX1 cDNA Clone

Gene Names
PINX1; LPTL; LPTS
Synonyms
PINX1; PINX1 cDNA Clone; PINX1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctatgctggctgaacgtcggcggaagcagaagtgggctgtggatcctcagaacactgcctggagtaatgacgattccaagtttggccagcggatgctagagaagatggggtggtctaaaggaaagggtttaggggctcaggagcacggagccacagatcatattaaagttcaagtgaaaaataaccacctgggactcggagctaccatcaataatgaagacaactggattgcccatcaggatgattttaaccagcttctggccgaactgaacacttgccatgggcaggaaaccacagattcctcggacaagaaggaaaagaaatcttttagccttgaggaaaagtccaaaatctccaaaaaccgtgttcactatatgaaattcacaaaagggaaggatctgtcatctcggagcaaaacagatcttgactgcatttttgggaaaagacagagtaagaagactcccgagggcgatgccagtccctccactccagaggagaacgaaaccacgacaaccagcgccttcaccatccaggagtactttgccaagcggatggcagcactgaagaacaagccccaggttccagttccagggtctgacatttctgagacgcaggtggaacgtaaaagggggaagaaaataaataaagaggccacaggtaaagatgtggaaagttacctccagcctaaggccaagaggcacacggagggaaagcccgagagggccgaggcccaggagcgagtggccaagaagaagagcgcgccagcagaagagcagctcagaggcccctgctgggaccagagttccaaggcctctgctcaggatgcaggggaccatgtgcagccgcctgagggccgggacttcaccctgaagcccaaaaagaggagagggaagaaaaagctgcaaaaaccagtagagatagcagaggacgctacactagaagaaacgctagtgaaaaagaagaagaagaaagattccaaatga
Sequence Length
987
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,714 Da
NCBI Official Full Name
Homo sapiens PIN2-interacting protein 1, mRNA
NCBI Official Synonym Full Names
PIN2/TERF1 interacting, telomerase inhibitor 1
NCBI Official Symbol
PINX1
NCBI Official Synonym Symbols
LPTL; LPTS
NCBI Protein Information
PIN2/TERF1-interacting telomerase inhibitor 1
UniProt Protein Name
PIN2/TERF1-interacting telomerase inhibitor 1
UniProt Gene Name
PINX1
UniProt Synonym Gene Names
LPTL; LPTS
UniProt Entry Name
PINX1_HUMAN

Uniprot Description

PINX1: Microtubule-binding protein essential for faithful chromosome segregation. Mediates TRF1 and TERT accumulation in nucleolus and enhances TRF1 binding to telomeres. Inhibits telomerase activity. May inhibit cell proliferation and act as tumor suppressor. Belongs to the PINX1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor; Inhibitor; Nucleolus

Chromosomal Location of Human Ortholog: 8p23

Cellular Component: cytoplasm; intracellular membrane-bound organelle; kinetochore; mitochondrion; nuclear chromosome; nuclear chromosome, telomeric region; nucleolus; nucleus; spindle

Molecular Function: protein binding

Biological Process: mitotic metaphase plate congression; negative regulation of protein ubiquitination; negative regulation of telomerase activity; negative regulation of telomere maintenance via telomerase; regulation of protein stability; regulation of telomerase activity

Research Articles on PINX1

Similar Products

Product Notes

The PINX1 pinx1 (Catalog #AAA1267157) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctatgc tggctgaacg tcggcggaag cagaagtggg ctgtggatcc tcagaacact gcctggagta atgacgattc caagtttggc cagcggatgc tagagaagat ggggtggtct aaaggaaagg gtttaggggc tcaggagcac ggagccacag atcatattaa agttcaagtg aaaaataacc acctgggact cggagctacc atcaataatg aagacaactg gattgcccat caggatgatt ttaaccagct tctggccgaa ctgaacactt gccatgggca ggaaaccaca gattcctcgg acaagaagga aaagaaatct tttagccttg aggaaaagtc caaaatctcc aaaaaccgtg ttcactatat gaaattcaca aaagggaagg atctgtcatc tcggagcaaa acagatcttg actgcatttt tgggaaaaga cagagtaaga agactcccga gggcgatgcc agtccctcca ctccagagga gaacgaaacc acgacaacca gcgccttcac catccaggag tactttgcca agcggatggc agcactgaag aacaagcccc aggttccagt tccagggtct gacatttctg agacgcaggt ggaacgtaaa agggggaaga aaataaataa agaggccaca ggtaaagatg tggaaagtta cctccagcct aaggccaaga ggcacacgga gggaaagccc gagagggccg aggcccagga gcgagtggcc aagaagaaga gcgcgccagc agaagagcag ctcagaggcc cctgctggga ccagagttcc aaggcctctg ctcaggatgc aggggaccat gtgcagccgc ctgagggccg ggacttcacc ctgaagccca aaaagaggag agggaagaaa aagctgcaaa aaccagtaga gatagcagag gacgctacac tagaagaaac gctagtgaaa aagaagaaga agaaagattc caaatga. It is sometimes possible for the material contained within the vial of "PINX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.