GATAD2A cdna clone
GATAD2A cDNA Clone
Gene Names
GATAD2A; p66alpha
Synonyms
GATAD2A; GATAD2A cDNA Clone; GATAD2A cdna clone
Sequence
atgatcaagcagctgaaggaagaattgaggttagaagaagcaaaactcgtgttgttgaaaaagttgcggcagagtcaaatacaaaaggaagccaccgcccagaagcccacaggttctgttgggagcaccgtgaccacccctcccccgcttgttcggggcactcagaacattcctgctggcaagccatcactccagacctcttcagctcggatgcccggcagtgtcatacccccgcccctggtccgaggtgggcagcaggcgtcctcgaagctggggccacaggcgagctcacaggtcgtcatgcccccactcgtcaggggggctcagcaaatccacagcattaggcaacattccagcacagggccaccgcccctcctcctggccccccgggcgtcggtgcccagtgtgcagattcagggacagaggatcatccagcagggcctcatccgcgtcgccaatgttcccaacaccagcctgctcgtcaacatcccacagcccaccccagcatcactgaaggggacaacagccacctccgctcaggccaactccacccccactagtgtggcctctgtggtcacctctgccgagtctccagcaagccgacaggcggccgccaagctggcgctgcgcaaacagctggagaagacgctactcgagatccccccacccaagcccccagccccagagatgaacttcctgcccagcgccgccaacaacgagttcatctacctggtcggcctggaggaggtggtgcagaacctactggagacacaaggcaggatgtcggccgccactgtgctgtcccgggagccctacatgtgtgcacagtgcaagacggacttcacgtgccgctggcgggaggagaagagcggcgccatcatgtgtgagaactgcatgacaaccaaccagaagaaggcgctcaaggtggagcacaccagccggctgaaggccgcctttgtgaaggcgctgcagcaggaacaggagattgagcagcggctcctgcagcagggcacggcccctgcacaggccaaggccgagcccaccgctgccccacaccccgtgctgaagcaggtcataaaaccccggcgtaagttggcgttccgctcaggagaggcccgcgactggagtaacggggctgtgctacaggcctccagccagctgtcccggggttcggccacgacgccccgaggtgtcctgcacacgttcagtccgtcacccaaactgcagaactcagcctcggccacagccctggtcagcaggaccggcagacattctgagagaaccgtgagcgccggcaagggcagcgccacctccaactggaagaagacgcccctcagcacaggcgggacccttgcgtttgtcagcccaagcctggcggtgcacaagagctcctcggccgtggaccgccagcgagagtacctcctggacatgatcccaccccgctccatcccccagtcagccacgtggaaatag
Sequence Length
1473
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,134 Da
NCBI Official Full Name
Homo sapiens GATA zinc finger domain containing 2A, mRNA
NCBI Official Synonym Full Names
GATA zinc finger domain containing 2A
NCBI Official Symbol
GATAD2A
NCBI Official Synonym Symbols
p66alpha
NCBI Protein Information
transcriptional repressor p66-alpha
UniProt Protein Name
Transcriptional repressor p66-alpha
Protein Family
UniProt Gene Name
GATAD2A
UniProt Synonym Gene Names
Hp66alpha
UniProt Entry Name
P66A_HUMAN
Uniprot Description
GATAD2A: Transcriptional repressor. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 19p13.11
Cellular Component: nucleoplasm; nucleus; NuRD complex
Molecular Function: protein binding; protein binding, bridging
Biological Process: DNA methylation; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent
Research Articles on GATAD2A
Similar Products
Product Notes
The GATAD2A gatad2a (Catalog #AAA1267132) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcaagc agctgaagga agaattgagg ttagaagaag caaaactcgt gttgttgaaa aagttgcggc agagtcaaat acaaaaggaa gccaccgccc agaagcccac aggttctgtt gggagcaccg tgaccacccc tcccccgctt gttcggggca ctcagaacat tcctgctggc aagccatcac tccagacctc ttcagctcgg atgcccggca gtgtcatacc cccgcccctg gtccgaggtg ggcagcaggc gtcctcgaag ctggggccac aggcgagctc acaggtcgtc atgcccccac tcgtcagggg ggctcagcaa atccacagca ttaggcaaca ttccagcaca gggccaccgc ccctcctcct ggccccccgg gcgtcggtgc ccagtgtgca gattcaggga cagaggatca tccagcaggg cctcatccgc gtcgccaatg ttcccaacac cagcctgctc gtcaacatcc cacagcccac cccagcatca ctgaagggga caacagccac ctccgctcag gccaactcca cccccactag tgtggcctct gtggtcacct ctgccgagtc tccagcaagc cgacaggcgg ccgccaagct ggcgctgcgc aaacagctgg agaagacgct actcgagatc cccccaccca agcccccagc cccagagatg aacttcctgc ccagcgccgc caacaacgag ttcatctacc tggtcggcct ggaggaggtg gtgcagaacc tactggagac acaaggcagg atgtcggccg ccactgtgct gtcccgggag ccctacatgt gtgcacagtg caagacggac ttcacgtgcc gctggcggga ggagaagagc ggcgccatca tgtgtgagaa ctgcatgaca accaaccaga agaaggcgct caaggtggag cacaccagcc ggctgaaggc cgcctttgtg aaggcgctgc agcaggaaca ggagattgag cagcggctcc tgcagcaggg cacggcccct gcacaggcca aggccgagcc caccgctgcc ccacaccccg tgctgaagca ggtcataaaa ccccggcgta agttggcgtt ccgctcagga gaggcccgcg actggagtaa cggggctgtg ctacaggcct ccagccagct gtcccggggt tcggccacga cgccccgagg tgtcctgcac acgttcagtc cgtcacccaa actgcagaac tcagcctcgg ccacagccct ggtcagcagg accggcagac attctgagag aaccgtgagc gccggcaagg gcagcgccac ctccaactgg aagaagacgc ccctcagcac aggcgggacc cttgcgtttg tcagcccaag cctggcggtg cacaagagct cctcggccgt ggaccgccag cgagagtacc tcctggacat gatcccaccc cgctccatcc cccagtcagc cacgtggaaa tag. It is sometimes possible for the material contained within the vial of "GATAD2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
